Incidental Mutation 'R4261:Arhgap9'
ID368361
Institutional Source Beutler Lab
Gene Symbol Arhgap9
Ensembl Gene ENSMUSG00000040345
Gene NameRho GTPase activating protein 9
Synonyms
MMRRC Submission 041074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4261 (G1)
Quality Score43
Status Validated
Chromosome10
Chromosomal Location127321964-127329943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 127328465 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 537 (R537P)
Ref Sequence ENSEMBL: ENSMUSP00000151690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026474] [ENSMUST00000069548] [ENSMUST00000219026] [ENSMUST00000219511]
Predicted Effect probably benign
Transcript: ENSMUST00000026474
SMART Domains Protein: ENSMUSP00000026474
Gene: ENSMUSG00000025407

DomainStartEndE-ValueType
low complexity region 222 237 N/A INTRINSIC
ZnF_C2H2 238 263 1.33e-1 SMART
ZnF_C2H2 271 298 5.72e-1 SMART
ZnF_C2H2 304 328 2.57e-3 SMART
ZnF_C2H2 334 359 1.92e-2 SMART
ZnF_C2H2 365 390 2.61e-4 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 540 562 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 850 873 N/A INTRINSIC
low complexity region 941 962 N/A INTRINSIC
low complexity region 985 1002 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069548
AA Change: R362P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066455
Gene: ENSMUSG00000040345
AA Change: R362P

DomainStartEndE-ValueType
PH 60 175 8.19e-10 SMART
RhoGAP 276 469 1.94e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218656
Predicted Effect probably damaging
Transcript: ENSMUST00000219026
AA Change: R362P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219511
AA Change: R537P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219640
Meta Mutation Damage Score 0.558 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho-GAP family of GTPase activating proteins. The protein has substantial GAP activity towards several Rho-family GTPases in vitro, converting them to an inactive GDP-bound state. It is implicated in regulating adhesion of hematopoietic cells to the extracellular matrix. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Adam9 G A 8: 24,964,907 Q733* probably null Het
Adamts4 C T 1: 171,259,104 P822S probably benign Het
Bsn T A 9: 108,110,684 probably benign Het
Car5a A T 8: 121,944,749 H15Q probably benign Het
Disp1 A T 1: 183,089,386 I490N probably damaging Het
Dlgap5 T G 14: 47,413,788 Y96S probably damaging Het
Dnah10 T A 5: 124,730,137 V162D possibly damaging Het
Dock7 A T 4: 99,003,886 M821K possibly damaging Het
Exoc3l T C 8: 105,290,967 R528G probably damaging Het
Fam234b G A 6: 135,209,136 G17E unknown Het
Grhl2 G A 15: 37,360,823 G617D possibly damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Hoxd9 C A 2: 74,695,687 probably benign Het
Hspa9 A G 18: 34,939,423 S550P probably damaging Het
Ide A C 19: 37,329,186 S63A unknown Het
Kat6b T A 14: 21,669,669 I1363N probably damaging Het
Ltbp1 T A 17: 75,291,367 C614* probably null Het
Mphosph8 A G 14: 56,674,465 D315G probably benign Het
Mthfr-ps1 A C 5: 78,474,483 noncoding transcript Het
Mug1 A G 6: 121,873,734 T730A probably benign Het
Myef2 T C 2: 125,115,479 T119A possibly damaging Het
Pald1 A G 10: 61,343,692 L466P probably damaging Het
Pcdh15 G A 10: 74,645,680 V286M probably damaging Het
Pcdhgb2 A G 18: 37,691,897 D647G probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Pkp4 A G 2: 59,305,162 Y126C probably damaging Het
Plppr1 A G 4: 49,300,993 I109V probably benign Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ppp2r5d G A 17: 46,687,081 Q219* probably null Het
Raf1 C T 6: 115,623,054 probably null Het
Rfx7 C T 9: 72,616,643 R372W probably damaging Het
Robo4 C A 9: 37,405,581 S397R probably benign Het
Sat1 T C X: 155,215,186 probably benign Het
Serpina1c T C 12: 103,897,080 K287R probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Ttn T A 2: 76,798,040 Y14592F probably damaging Het
Ube3b T C 5: 114,398,428 F245S possibly damaging Het
Ugt3a2 G A 15: 9,335,793 probably null Het
Wdr91 T A 6: 34,904,522 S297C possibly damaging Het
Zcwpw2 T C 9: 117,998,914 noncoding transcript Het
Other mutations in Arhgap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Arhgap9 APN 10 127327893 splice site probably benign
IGL01069:Arhgap9 APN 10 127328952 missense probably damaging 1.00
IGL02444:Arhgap9 APN 10 127327947 missense probably damaging 1.00
IGL02707:Arhgap9 APN 10 127329607 missense probably damaging 0.98
R0242:Arhgap9 UTSW 10 127329538 missense probably benign 0.13
R0242:Arhgap9 UTSW 10 127329538 missense probably benign 0.13
R0841:Arhgap9 UTSW 10 127329639 missense probably damaging 0.98
R1084:Arhgap9 UTSW 10 127327928 missense probably damaging 1.00
R1707:Arhgap9 UTSW 10 127328889 missense probably benign 0.00
R1799:Arhgap9 UTSW 10 127327724 missense probably damaging 1.00
R2423:Arhgap9 UTSW 10 127327124 unclassified probably null
R2511:Arhgap9 UTSW 10 127328985 critical splice donor site probably null
R3721:Arhgap9 UTSW 10 127328971 missense possibly damaging 0.84
R3803:Arhgap9 UTSW 10 127329517 missense possibly damaging 0.64
R4968:Arhgap9 UTSW 10 127327006 missense possibly damaging 0.80
R5423:Arhgap9 UTSW 10 127329549 missense probably damaging 1.00
R5425:Arhgap9 UTSW 10 127326418 missense probably damaging 1.00
R6697:Arhgap9 UTSW 10 127322120 missense probably benign 0.34
R6969:Arhgap9 UTSW 10 127326643 missense probably benign 0.39
X0067:Arhgap9 UTSW 10 127328432 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGAATTCCTAGCCTTTGAG -3'
(R):5'- CCTTGCTGCAGAACCAAAGC -3'

Sequencing Primer
(F):5'- CAGAATTCCTAGCCTTTGAGTCAGG -3'
(R):5'- CCTCCGAGAATAATTCAGAGGGTTAC -3'
Posted On2016-02-01