Incidental Mutation 'R4287:Rrs1'
ID368370
Institutional Source Beutler Lab
Gene Symbol Rrs1
Ensembl Gene ENSMUSG00000061024
Gene Nameribosome biogenesis regulator 1
Synonyms5730466A07Rik, D1Ertd701e
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4287 (G1)
Quality Score20
Status Validated
Chromosome1
Chromosomal Location9545408-9547455 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 9546215 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 231 (S231L)
Ref Sequence ENSEMBL: ENSMUSP00000071955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027044] [ENSMUST00000072079] [ENSMUST00000130927] [ENSMUST00000144177] [ENSMUST00000186467]
Predicted Effect probably benign
Transcript: ENSMUST00000027044
Predicted Effect probably damaging
Transcript: ENSMUST00000072079
AA Change: S231L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071955
Gene: ENSMUSG00000061024
AA Change: S231L

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:RRS1 31 193 3.5e-62 PFAM
low complexity region 302 337 N/A INTRINSIC
low complexity region 351 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130927
Predicted Effect probably benign
Transcript: ENSMUST00000144177
SMART Domains Protein: ENSMUSP00000116627
Gene: ENSMUSG00000025911

DomainStartEndE-ValueType
Pfam:Fe-ADH 50 454 2.1e-105 PFAM
Pfam:Fe-ADH_2 53 155 6.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186467
Predicted Effect probably benign
Transcript: ENSMUST00000190654
Meta Mutation Damage Score 0.0244 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Rrs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03098:Rrs1 UTSW 1 9546103 frame shift probably null
PIT1430001:Rrs1 UTSW 1 9545925 missense probably damaging 1.00
R0207:Rrs1 UTSW 1 9545762 unclassified probably null
R0207:Rrs1 UTSW 1 9545767 missense probably damaging 0.96
R0577:Rrs1 UTSW 1 9545801 unclassified probably null
R1165:Rrs1 UTSW 1 9545767 missense probably damaging 0.96
R1222:Rrs1 UTSW 1 9545855 missense probably benign 0.00
R1238:Rrs1 UTSW 1 9545801 unclassified probably null
R1397:Rrs1 UTSW 1 9545767 missense probably damaging 0.96
R1598:Rrs1 UTSW 1 9545912 missense probably benign 0.15
R2338:Rrs1 UTSW 1 9545801 unclassified probably null
R4280:Rrs1 UTSW 1 9546139 missense probably damaging 0.96
R4287:Rrs1 UTSW 1 9546223 missense possibly damaging 0.82
R4298:Rrs1 UTSW 1 9546223 missense possibly damaging 0.82
R4326:Rrs1 UTSW 1 9546341 missense possibly damaging 0.95
R4475:Rrs1 UTSW 1 9545585 missense probably damaging 1.00
R4566:Rrs1 UTSW 1 9546227 missense probably damaging 1.00
R4986:Rrs1 UTSW 1 9545767 missense probably damaging 0.96
R6597:Rrs1 UTSW 1 9546376 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGACCAGTTCGCCAAGAGG -3'
(R):5'- CTTGCCAGCTAAAGCAGAAGG -3'

Sequencing Primer
(F):5'- CAGTTCGCCAAGAGGACTCAG -3'
(R):5'- AGGAATGCTTTTTGCTTCCCAAG -3'
Posted On2016-02-02