Incidental Mutation 'R4287:Mpp3'
ID368373
Institutional Source Beutler Lab
Gene Symbol Mpp3
Ensembl Gene ENSMUSG00000052373
Gene Namemembrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
SynonymsDlgh3
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101999652-102028461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102023463 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 102 (A102V)
Ref Sequence ENSEMBL: ENSMUSP00000102786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062801] [ENSMUST00000100400] [ENSMUST00000107167] [ENSMUST00000107168]
Predicted Effect probably damaging
Transcript: ENSMUST00000062801
AA Change: A102V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055469
Gene: ENSMUSG00000052373
AA Change: A102V

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100400
AA Change: A102V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097969
Gene: ENSMUSG00000052373
AA Change: A102V

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107167
AA Change: A102V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102785
Gene: ENSMUSG00000052373
AA Change: A102V

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 215 5.86e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107168
AA Change: A102V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102786
Gene: ENSMUSG00000052373
AA Change: A102V

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155751
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. This protein contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. Alternatively spliced transcript variants have been identified. One transcript variant is experimentally supported, but it doesn't encode a protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Mpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Mpp3 APN 11 102002103 missense possibly damaging 0.76
IGL01337:Mpp3 APN 11 102000585 missense probably benign
IGL01393:Mpp3 APN 11 102025478 missense probably damaging 0.99
IGL01544:Mpp3 APN 11 102018659 missense possibly damaging 0.91
IGL02152:Mpp3 APN 11 102025390 nonsense probably null
IGL02441:Mpp3 APN 11 102009675 missense probably benign 0.00
IGL02656:Mpp3 APN 11 102008601 missense probably benign
R0013:Mpp3 UTSW 11 102005425 missense probably benign 0.27
R0117:Mpp3 UTSW 11 102000573 missense probably damaging 1.00
R0564:Mpp3 UTSW 11 102005347 missense possibly damaging 0.87
R1372:Mpp3 UTSW 11 102000575 missense probably damaging 0.96
R1531:Mpp3 UTSW 11 102008649 missense probably benign
R1639:Mpp3 UTSW 11 102023442 missense probably damaging 1.00
R1720:Mpp3 UTSW 11 102025756 start codon destroyed possibly damaging 0.79
R1968:Mpp3 UTSW 11 102018552 intron probably benign
R2064:Mpp3 UTSW 11 102000690 missense probably benign 0.01
R2363:Mpp3 UTSW 11 102020486 missense probably damaging 1.00
R3775:Mpp3 UTSW 11 102023367 nonsense probably null
R3776:Mpp3 UTSW 11 102023367 nonsense probably null
R4208:Mpp3 UTSW 11 102000600 missense probably benign
R4327:Mpp3 UTSW 11 102023511 intron probably benign
R4329:Mpp3 UTSW 11 102023511 intron probably benign
R4367:Mpp3 UTSW 11 102023420 missense probably benign 0.01
R4856:Mpp3 UTSW 11 102025136 missense probably benign
R4886:Mpp3 UTSW 11 102025136 missense probably benign
R4904:Mpp3 UTSW 11 102000587 missense probably benign 0.01
R4946:Mpp3 UTSW 11 102005022 missense probably benign 0.01
R5405:Mpp3 UTSW 11 102010221 missense probably benign
R5935:Mpp3 UTSW 11 102025415 missense probably damaging 1.00
R6020:Mpp3 UTSW 11 102018539 intron probably benign
R6056:Mpp3 UTSW 11 102011689 intron probably null
R6151:Mpp3 UTSW 11 102008566 missense probably benign 0.11
R6677:Mpp3 UTSW 11 102008618 missense probably benign
R6784:Mpp3 UTSW 11 102002148 critical splice acceptor site probably null
R6855:Mpp3 UTSW 11 102013325 missense probably benign 0.09
R7227:Mpp3 UTSW 11 102005078 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTCACTGTGAACTCGGGGAAG -3'
(R):5'- AAGTTGTGTCTCCTGGGACG -3'

Sequencing Primer
(F):5'- GGTGCCTTCCGGGTCTTC -3'
(R):5'- TGGAGAGAGAGCTGGAGTCCTG -3'
Posted On2016-02-02