Incidental Mutation 'R4153:Fanca'
ID368382
Institutional Source Beutler Lab
Gene Symbol Fanca
Ensembl Gene ENSMUSG00000032815
Gene NameFanconi anemia, complementation group A
Synonyms
MMRRC Submission 040997-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.721) question?
Stock #R4153 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123268300-123318576 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123304878 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 358 (V358A)
Ref Sequence ENSEMBL: ENSMUSP00000113125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035495] [ENSMUST00000118395] [ENSMUST00000127664] [ENSMUST00000127904]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035495
AA Change: V358A

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815
AA Change: V358A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118395
AA Change: V358A

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113125
Gene: ENSMUSG00000032815
AA Change: V358A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000127904
AA Change: V260A

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116614
Gene: ENSMUSG00000032815
AA Change: V260A

DomainStartEndE-ValueType
low complexity region 547 562 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212953
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,193,173 V47A probably benign Het
4932414N04Rik A T 2: 68,668,597 probably benign Het
Acat2 T A 17: 12,952,266 H159L possibly damaging Het
Acsl5 A G 19: 55,281,463 E253G probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ebf2 T G 14: 67,235,223 V30G probably damaging Het
Erlin1 T A 19: 44,067,617 T60S probably benign Het
Fastkd3 T C 13: 68,590,138 F602S probably damaging Het
Fras1 C A 5: 96,776,735 N3678K probably benign Het
Gm5346 T A 8: 43,626,527 Y220F probably benign Het
Gopc T C 10: 52,349,143 I277V probably damaging Het
Gpd2 A G 2: 57,355,771 T438A probably damaging Het
Gzma T C 13: 113,096,268 K97E possibly damaging Het
Gzmn T A 14: 56,167,842 T62S probably damaging Het
Hip1 T C 5: 135,412,706 E570G probably damaging Het
Hs3st6 T C 17: 24,758,365 V273A possibly damaging Het
Jarid2 C A 13: 44,910,426 S873R probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mast2 T C 4: 116,315,963 N548S possibly damaging Het
Mthfr G T 4: 148,051,475 R335L probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nwd1 T C 8: 72,681,936 L808P probably damaging Het
Olfr681 A T 7: 105,122,309 H284L probably damaging Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pigk G A 3: 152,740,129 V126I probably damaging Het
Plcl2 A T 17: 50,606,361 K133* probably null Het
Pofut2 A G 10: 77,268,666 K426E probably benign Het
Rbpj T A 5: 53,649,447 H230Q probably damaging Het
Rnf213 A G 11: 119,409,482 K269E probably benign Het
Shh A T 5: 28,457,949 I407N probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Svep1 A T 4: 58,089,426 F1661Y possibly damaging Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Thrap3 A C 4: 126,173,442 probably null Het
Thumpd1 C T 7: 119,720,593 C50Y probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnrc18 T C 5: 142,765,992 D1368G possibly damaging Het
Tubd1 G A 11: 86,549,470 G107S probably damaging Het
Ugt1a6a A G 1: 88,138,471 probably null Het
Uty A G Y: 1,158,327 V572A possibly damaging Het
Vmn1r171 A G 7: 23,632,652 K89E probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r106 A G 17: 20,267,818 L773P probably damaging Het
Vps13b T A 15: 35,792,027 probably null Het
Other mutations in Fanca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02348:Fanca APN 8 123305263 missense probably damaging 1.00
IGL02805:Fanca APN 8 123289494 missense probably damaging 0.99
IGL03280:Fanca APN 8 123316459 unclassified probably benign
PIT4402001:Fanca UTSW 8 123313064 missense possibly damaging 0.83
R0114:Fanca UTSW 8 123288491 splice site probably null
R0115:Fanca UTSW 8 123268539 missense probably benign 0.00
R0271:Fanca UTSW 8 123272441 unclassified probably benign
R0330:Fanca UTSW 8 123274172 nonsense probably null
R0345:Fanca UTSW 8 123304813 missense probably damaging 1.00
R0570:Fanca UTSW 8 123306430 missense probably benign 0.01
R0601:Fanca UTSW 8 123308513 missense probably damaging 0.99
R0617:Fanca UTSW 8 123288070 missense probably damaging 0.99
R0639:Fanca UTSW 8 123289359 critical splice donor site probably null
R0943:Fanca UTSW 8 123274186 missense probably damaging 1.00
R1140:Fanca UTSW 8 123313129 splice site probably null
R1364:Fanca UTSW 8 123304281 splice site probably benign
R1366:Fanca UTSW 8 123304281 splice site probably benign
R1367:Fanca UTSW 8 123304281 splice site probably benign
R1368:Fanca UTSW 8 123304281 splice site probably benign
R1969:Fanca UTSW 8 123288064 missense probably benign 0.41
R1992:Fanca UTSW 8 123297812 missense possibly damaging 0.94
R2060:Fanca UTSW 8 123274481 missense probably damaging 1.00
R2174:Fanca UTSW 8 123271270 missense probably benign 0.00
R2261:Fanca UTSW 8 123289359 critical splice donor site probably null
R3957:Fanca UTSW 8 123316363 missense probably benign 0.00
R4062:Fanca UTSW 8 123275172 missense probably benign 0.00
R4270:Fanca UTSW 8 123268794 missense probably damaging 1.00
R4424:Fanca UTSW 8 123288793 missense probably benign 0.11
R4581:Fanca UTSW 8 123274338 unclassified probably null
R4639:Fanca UTSW 8 123318150 missense probably damaging 0.98
R4664:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4665:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4666:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4686:Fanca UTSW 8 123268934 splice site probably benign
R4775:Fanca UTSW 8 123296306 missense probably damaging 0.99
R4782:Fanca UTSW 8 123288202 missense probably damaging 1.00
R4799:Fanca UTSW 8 123288202 missense probably damaging 1.00
R4926:Fanca UTSW 8 123303985 missense probably benign 0.05
R4973:Fanca UTSW 8 123308522 missense probably damaging 0.96
R5039:Fanca UTSW 8 123284046 missense probably benign
R5195:Fanca UTSW 8 123303945 intron probably benign
R5590:Fanca UTSW 8 123303963 intron probably benign
R5848:Fanca UTSW 8 123295053 intron probably benign
R5965:Fanca UTSW 8 123316410 missense possibly damaging 0.46
R6224:Fanca UTSW 8 123305281 missense possibly damaging 0.87
R6385:Fanca UTSW 8 123305867 unclassified probably null
R6762:Fanca UTSW 8 123271303 missense probably benign 0.26
R6795:Fanca UTSW 8 123318493 missense probably benign 0.02
R6810:Fanca UTSW 8 123286477 missense probably damaging 0.99
R7153:Fanca UTSW 8 123316425 missense probably damaging 1.00
V7732:Fanca UTSW 8 123304281 splice site probably benign
X0025:Fanca UTSW 8 123276548 intron probably benign
X0062:Fanca UTSW 8 123304852 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TACAGTGTGGGACAAGACTCAC -3'
(R):5'- AAGAATTCTTCCGGCCACTGC -3'

Sequencing Primer
(F):5'- TGGGACAAGACTCACATCTGCATG -3'
(R):5'- TGCTGACCACTGCAGAGAG -3'
Posted On2016-02-03