Incidental Mutation 'R4153:Tubd1'
ID368383
Institutional Source Beutler Lab
Gene Symbol Tubd1
Ensembl Gene ENSMUSG00000020513
Gene Nametubulin, delta 1
Synonyms4930550G19Rik
MMRRC Submission 040997-MU
Accession Numbers

Ncbi RefSeq: NM_001199045.1, NM_019756.3, NM_001199046.1, NM_001199047.1; MGI:1891826

Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R4153 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86544991-86567360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86549470 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 107 (G107S)
Ref Sequence ENSEMBL: ENSMUSP00000130909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020821] [ENSMUST00000058286] [ENSMUST00000069503] [ENSMUST00000108030] [ENSMUST00000138810] [ENSMUST00000154617] [ENSMUST00000167178]
Predicted Effect probably damaging
Transcript: ENSMUST00000020821
AA Change: G107S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020821
Gene: ENSMUSG00000020513
AA Change: G107S

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
Blast:Tubulin 273 323 1e-12 BLAST
SCOP:d1tubb2 289 481 6e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000020824
Predicted Effect probably benign
Transcript: ENSMUST00000058286
SMART Domains Protein: ENSMUSP00000053188
Gene: ENSMUSG00000020516

DomainStartEndE-ValueType
Pfam:Pkinase 91 202 1.2e-19 PFAM
Pfam:Pkinase_Tyr 91 253 5.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000069503
AA Change: G107S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064383
Gene: ENSMUSG00000020513
AA Change: G107S

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
SCOP:d1tubb2 256 450 1e-25 SMART
Blast:Tubulin 258 292 1e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108030
AA Change: G107S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103665
Gene: ENSMUSG00000020513
AA Change: G107S

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
Blast:Tubulin 273 323 1e-12 BLAST
SCOP:d1tubb2 289 481 6e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138810
SMART Domains Protein: ENSMUSP00000122756
Gene: ENSMUSG00000020516

DomainStartEndE-ValueType
SCOP:d1koba_ 13 74 9e-13 SMART
PDB:4L3L|A 21 74 6e-30 PDB
Blast:S_TKc 38 74 7e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154617
SMART Domains Protein: ENSMUSP00000119715
Gene: ENSMUSG00000020516

DomainStartEndE-ValueType
S_TKc 91 352 8.24e-107 SMART
S_TK_X 353 415 9.2e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167178
AA Change: G107S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130909
Gene: ENSMUSG00000020513
AA Change: G107S

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
SCOP:d1tubb2 256 450 1e-25 SMART
Blast:Tubulin 258 292 1e-11 BLAST
Meta Mutation Damage Score 0.596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,193,173 V47A probably benign Het
4932414N04Rik A T 2: 68,668,597 probably benign Het
Acat2 T A 17: 12,952,266 H159L possibly damaging Het
Acsl5 A G 19: 55,281,463 E253G probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ebf2 T G 14: 67,235,223 V30G probably damaging Het
Erlin1 T A 19: 44,067,617 T60S probably benign Het
Fanca A G 8: 123,304,878 V358A possibly damaging Het
Fastkd3 T C 13: 68,590,138 F602S probably damaging Het
Fras1 C A 5: 96,776,735 N3678K probably benign Het
Gm5346 T A 8: 43,626,527 Y220F probably benign Het
Gopc T C 10: 52,349,143 I277V probably damaging Het
Gpd2 A G 2: 57,355,771 T438A probably damaging Het
Gzma T C 13: 113,096,268 K97E possibly damaging Het
Gzmn T A 14: 56,167,842 T62S probably damaging Het
Hip1 T C 5: 135,412,706 E570G probably damaging Het
Hs3st6 T C 17: 24,758,365 V273A possibly damaging Het
Jarid2 C A 13: 44,910,426 S873R probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mast2 T C 4: 116,315,963 N548S possibly damaging Het
Mthfr G T 4: 148,051,475 R335L probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nwd1 T C 8: 72,681,936 L808P probably damaging Het
Olfr681 A T 7: 105,122,309 H284L probably damaging Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pigk G A 3: 152,740,129 V126I probably damaging Het
Plcl2 A T 17: 50,606,361 K133* probably null Het
Pofut2 A G 10: 77,268,666 K426E probably benign Het
Rbpj T A 5: 53,649,447 H230Q probably damaging Het
Rnf213 A G 11: 119,409,482 K269E probably benign Het
Shh A T 5: 28,457,949 I407N probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Svep1 A T 4: 58,089,426 F1661Y possibly damaging Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Thrap3 A C 4: 126,173,442 probably null Het
Thumpd1 C T 7: 119,720,593 C50Y probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnrc18 T C 5: 142,765,992 D1368G possibly damaging Het
Ugt1a6a A G 1: 88,138,471 probably null Het
Uty A G Y: 1,158,327 V572A possibly damaging Het
Vmn1r171 A G 7: 23,632,652 K89E probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r106 A G 17: 20,267,818 L773P probably damaging Het
Vps13b T A 15: 35,792,027 probably null Het
Other mutations in Tubd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Tubd1 APN 11 86565729 missense probably benign 0.07
IGL00465:Tubd1 APN 11 86555068 splice site probably benign
IGL03088:Tubd1 APN 11 86552999 missense probably damaging 1.00
IGL03383:Tubd1 APN 11 86549008 splice site probably benign
R0039:Tubd1 UTSW 11 86549395 nonsense probably null
R0427:Tubd1 UTSW 11 86557790 missense possibly damaging 0.94
R0482:Tubd1 UTSW 11 86557776 missense possibly damaging 0.89
R2305:Tubd1 UTSW 11 86555191 missense probably benign 0.38
R4436:Tubd1 UTSW 11 86548919 missense probably benign 0.02
R4773:Tubd1 UTSW 11 86555302 missense possibly damaging 0.83
R4793:Tubd1 UTSW 11 86567069 missense probably benign 0.19
R4890:Tubd1 UTSW 11 86552795 missense possibly damaging 0.83
R4908:Tubd1 UTSW 11 86567053 missense probably damaging 1.00
R4990:Tubd1 UTSW 11 86557839 missense probably damaging 1.00
R5004:Tubd1 UTSW 11 86561320 missense probably damaging 0.98
R6192:Tubd1 UTSW 11 86557793 missense probably benign 0.32
R7108:Tubd1 UTSW 11 86557805 missense probably damaging 0.99
Z1088:Tubd1 UTSW 11 86555167 missense probably damaging 1.00
Z1088:Tubd1 UTSW 11 86549470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTTACGCTCTGTGGTACC -3'
(R):5'- TGAGTTGAACCAGTCAGAGCTC -3'

Sequencing Primer
(F):5'- CCTACTCTAGTTCCAGTTGC -3'
(R):5'- TTGAACCAGTCAGAGCTCAGAAAG -3'
Posted On2016-02-03