Incidental Mutation 'R4214:Gm14393'
ID368388
Institutional Source Beutler Lab
Gene Symbol Gm14393
Ensembl Gene ENSMUSG00000078905
Gene Namepredicted gene 14393
Synonyms
MMRRC Submission 041041-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4214 (G1)
Quality Score41
Status Validated
Chromosome2
Chromosomal Location175061549-175067781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 175061847 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 89 (C89Y)
Ref Sequence ENSEMBL: ENSMUSP00000072668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072895] [ENSMUST00000109066]
Predicted Effect probably benign
Transcript: ENSMUST00000072895
AA Change: C89Y

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000072668
Gene: ENSMUSG00000078905
AA Change: C89Y

DomainStartEndE-ValueType
KRAB 4 66 9.34e-15 SMART
ZnF_C2H2 103 125 8.47e-4 SMART
ZnF_C2H2 131 153 9.22e-5 SMART
ZnF_C2H2 159 181 1.03e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109066
SMART Domains Protein: ENSMUSP00000104694
Gene: ENSMUSG00000078905

DomainStartEndE-ValueType
KRAB 4 64 1.21e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122320
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Adamts5 G A 16: 85,868,643 A590V probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
Atp2b3 A G X: 73,570,315 M1142V probably benign Het
AU041133 A G 10: 82,151,389 H292R probably damaging Het
Bco2 A G 9: 50,545,366 M158T probably benign Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Catsperg1 T C 7: 29,195,932 R499G possibly damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Fez1 A G 9: 36,870,488 N20S probably damaging Het
Folr2 T G 7: 101,843,699 K39T probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Gpr162 A T 6: 124,860,068 W338R probably damaging Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Nab2 G T 10: 127,665,048 Y25* probably null Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Pfkp A G 13: 6,619,225 S241P probably damaging Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Tbx18 T C 9: 87,724,465 Y209C probably damaging Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Vmn1r213 G A 13: 23,012,003 C252Y possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in Gm14393
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02873:Gm14393 APN 2 175061802 missense possibly damaging 0.53
IGL03049:Gm14393 APN 2 175061788 missense probably damaging 1.00
FR4340:Gm14393 UTSW 2 175061634 missense possibly damaging 0.48
FR4976:Gm14393 UTSW 2 175061820 missense probably benign
R1470:Gm14393 UTSW 2 175063981 missense probably damaging 1.00
R1470:Gm14393 UTSW 2 175063981 missense probably damaging 1.00
R3940:Gm14393 UTSW 2 175061627 unclassified probably null
R4585:Gm14393 UTSW 2 175062704 unclassified probably benign
R4586:Gm14393 UTSW 2 175062704 unclassified probably benign
R5431:Gm14393 UTSW 2 175063876 missense probably damaging 0.97
R5553:Gm14393 UTSW 2 175061846 nonsense probably null
R5942:Gm14393 UTSW 2 175061896 nonsense probably null
R6497:Gm14393 UTSW 2 175061634 missense possibly damaging 0.48
R7154:Gm14393 UTSW 2 175061783 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAATCCTTCCTGCAAAGGC -3'
(R):5'- AGCCAGATAATCAGTACTGTTCCC -3'

Sequencing Primer
(F):5'- ACGACTGTTTCCTGCAAAGG -3'
(R):5'- CCCATTTCATATATCCTCGAAGATG -3'
Posted On2016-02-03