Incidental Mutation 'R4790:Frem2'
ID368423
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene NameFras1 related extracellular matrix protein 2
Synonymsmy, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission 042418-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4790 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location53513938-53657355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53516741 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 3092 (W3092R)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
Predicted Effect probably benign
Transcript: ENSMUST00000091137
AA Change: W3092R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: W3092R

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199543
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,930,552 I162N probably damaging Het
Abca5 T G 11: 110,311,410 T390P possibly damaging Het
Acss3 A T 10: 107,023,702 Y345* probably null Het
Adam26b A T 8: 43,520,727 S413T probably benign Het
Angpt2 T A 8: 18,714,082 Q148L probably damaging Het
Ank3 T A 10: 69,988,151 Y883* probably null Het
Ankrd52 A G 10: 128,380,945 K190E possibly damaging Het
Anks1b A G 10: 90,163,275 R415G probably damaging Het
Ano3 T A 2: 110,884,919 Q58L probably benign Het
Arhgap39 A T 15: 76,726,731 M924K possibly damaging Het
AU040320 A G 4: 126,847,215 M910V possibly damaging Het
BC051019 T A 7: 109,716,346 H86L probably benign Het
C1qbp G A 11: 70,980,030 Q151* probably null Het
C4b G T 17: 34,734,143 D1069E probably benign Het
C77080 C A 4: 129,223,302 R523L probably damaging Het
Casp1 C T 9: 5,303,020 T158I probably benign Het
Casq1 T C 1: 172,216,837 D141G probably damaging Het
Ccdc33 T A 9: 58,029,957 E653V probably damaging Het
Cd180 C T 13: 102,702,822 T71M probably damaging Het
Cdk4 T C 10: 127,064,701 L112P probably damaging Het
Celf2 A G 2: 6,549,903 F425S probably damaging Het
Chrm3 A T 13: 9,877,662 V446E probably benign Het
Chst9 A T 18: 15,453,050 L152H probably damaging Het
Cib2 A G 9: 54,549,803 probably null Het
Clec18a T C 8: 111,072,085 S366G probably damaging Het
Crebbp A G 16: 4,180,119 F34L probably damaging Het
Dapk1 AT A 13: 60,723,105 probably null Het
Ddi1 T A 9: 6,265,761 M203L probably benign Het
Ddx20 G T 3: 105,683,169 S270R probably benign Het
Epp13 A T 7: 6,266,318 K31* probably null Het
Espnl A T 1: 91,344,424 E458V probably damaging Het
Fat3 T C 9: 15,998,484 D2074G probably damaging Het
Fcf1 A G 12: 84,974,128 T61A probably benign Het
Fkbp15 T C 4: 62,307,997 R772G probably benign Het
Flnb T C 14: 7,905,661 V1137A probably benign Het
Fosb C A 7: 19,309,388 C15F probably damaging Het
Gm3248 T C 14: 5,945,831 I28V probably damaging Het
Gm4922 G T 10: 18,784,168 L269I possibly damaging Het
Gucy2e G A 11: 69,228,448 R627W probably damaging Het
Hephl1 T A 9: 15,059,171 E1009V probably damaging Het
Hsf4 A T 8: 105,270,605 Q61L probably damaging Het
Itgam T A 7: 128,116,273 N1046K probably benign Het
Itgav G A 2: 83,755,810 C138Y probably damaging Het
Itih4 A T 14: 30,889,910 Y157F probably damaging Het
Kcnt2 C T 1: 140,354,516 R80C probably damaging Het
Kdm4b G A 17: 56,401,618 V986M probably damaging Het
Lamb3 T A 1: 193,339,886 V1014D probably damaging Het
Lrrc74b G T 16: 17,549,853 N282K probably damaging Het
Map3k20 T A 2: 72,441,704 H725Q probably benign Het
Mink1 A G 11: 70,599,041 N81S probably damaging Het
Mmp21 A G 7: 133,675,030 Y415H probably damaging Het
Mycbp2 A T 14: 103,229,437 W1297R probably damaging Het
Myh8 T C 11: 67,279,963 M95T probably damaging Het
Myo7b A T 18: 32,000,105 probably null Het
Nanog A G 6: 122,707,915 M20V probably benign Het
Ncapd3 A G 9: 27,051,850 I484V probably benign Het
Ndufa12 A T 10: 94,220,758 N116I probably benign Het
Nedd4l A G 18: 65,203,945 I668V possibly damaging Het
Nobox T C 6: 43,305,546 D309G probably benign Het
Npnt A G 3: 132,890,762 probably benign Het
Nrxn1 A C 17: 90,455,049 Y2D possibly damaging Het
Obox6 G T 7: 15,834,577 P125T possibly damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1079 T C 2: 86,538,880 T10A possibly damaging Het
Olfr1193 T A 2: 88,678,387 N177K possibly damaging Het
Olfr1436 A G 19: 12,298,941 Y64H possibly damaging Het
Olfr202 A T 16: 59,284,458 V13D probably damaging Het
Olfr679 T C 7: 105,086,637 probably benign Het
Olfr697 C G 7: 106,741,791 V48L probably benign Het
Olfr761 T C 17: 37,952,742 Y94C probably damaging Het
Osm A T 11: 4,238,435 M21L probably benign Het
Otogl T A 10: 107,822,033 probably null Het
Otud4 T G 8: 79,666,773 S493A possibly damaging Het
Pars2 A G 4: 106,651,111 probably benign Het
Phlda3 T A 1: 135,766,819 V124E possibly damaging Het
Pias4 T C 10: 81,157,492 D199G probably damaging Het
Pm20d1 T C 1: 131,812,039 L375P probably benign Het
Pole2 T C 12: 69,226,365 I48V probably benign Het
Prrc2c T C 1: 162,710,481 R527G unknown Het
Rasgrf2 G T 13: 91,988,016 N592K probably damaging Het
Rbm7 A G 9: 48,495,174 L26P probably damaging Het
Rhag A G 17: 40,831,290 H208R probably benign Het
Rnf17 A G 14: 56,434,355 E268G probably damaging Het
Rnf220 A G 4: 117,289,055 V23A probably benign Het
Rnf7 A T 9: 96,478,419 V55D probably damaging Het
Sdr9c7 C A 10: 127,903,579 R188S possibly damaging Het
Senp6 T A 9: 80,089,858 N51K probably benign Het
Skint3 C A 4: 112,255,898 T235K possibly damaging Het
Slc10a5 A G 3: 10,335,036 F188S probably damaging Het
Slc41a1 G A 1: 131,830,952 G111R probably damaging Het
Smarca1 T C X: 47,884,067 D132G probably null Het
Snrnp48 C T 13: 38,221,323 R299W probably damaging Het
Sspo G A 6: 48,460,771 G1413D probably benign Het
Star T A 8: 25,808,616 H16Q probably damaging Het
Strc T C 2: 121,375,594 D779G probably benign Het
Sulf2 T C 2: 166,089,295 Y264C probably damaging Het
Supt7l A G 5: 31,522,904 S6P possibly damaging Het
Syne2 A G 12: 76,020,391 D4289G probably benign Het
Szrd1 A T 4: 141,139,690 probably null Het
Tada1 T C 1: 166,391,954 V275A possibly damaging Het
Tbr1 A T 2: 61,811,588 Y136F probably benign Het
Tbx20 T A 9: 24,725,714 H359L probably benign Het
Thbs4 G T 13: 92,762,806 D560E probably damaging Het
Tnfsf14 T C 17: 57,190,740 H164R probably damaging Het
Trmu T C 15: 85,882,805 S72P probably damaging Het
Tsnaxip1 C A 8: 105,833,523 Q36K probably benign Het
Ttc28 T A 5: 111,224,217 M844K possibly damaging Het
Tubgcp2 T C 7: 139,999,288 Y695C probably damaging Het
Ugt1a10 T A 1: 88,056,287 M269K probably damaging Het
Urb1 A T 16: 90,769,555 L1448* probably null Het
Vmn2r124 A T 17: 18,049,593 H37L probably damaging Het
Vmn2r44 T C 7: 8,367,950 N699S probably damaging Het
Vps35 A T 8: 85,278,857 probably null Het
Yipf1 G T 4: 107,336,199 probably null Het
Zfp395 A G 14: 65,386,541 N153S possibly damaging Het
Zfp395 A G 14: 65,393,207 D402G probably damaging Het
Zfp652 T C 11: 95,749,609 V120A probably damaging Het
Zp3r T C 1: 130,582,892 I364M probably damaging Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACATCATGGGCTCAGTGCTTC -3'
(R):5'- CAACACCCATCGAGGCATTG -3'

Sequencing Primer
(F):5'- CCAGAGCCCTTTGGAGTATC -3'
(R):5'- AGTACCAGTATCACTCAGTGGTGC -3'
Posted On2016-02-04