Incidental Mutation 'R0418:Lrrc31'
ID36852
Institutional Source Beutler Lab
Gene Symbol Lrrc31
Ensembl Gene ENSMUSG00000074653
Gene Nameleucine rich repeat containing 31
Synonyms
MMRRC Submission 038620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0418 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location30679058-30699843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30689234 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 194 (L194Q)
Ref Sequence ENSEMBL: ENSMUSP00000103898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108263] [ENSMUST00000126658]
Predicted Effect probably damaging
Transcript: ENSMUST00000108263
AA Change: L194Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103898
Gene: ENSMUSG00000074653
AA Change: L194Q

DomainStartEndE-ValueType
LRR 92 119 4.5e-2 SMART
Blast:LRR 148 175 1e-8 BLAST
LRR 176 203 2.6e-1 SMART
LRR 204 231 6.7e-2 SMART
LRR 260 287 1e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126658
AA Change: L194Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120802
Gene: ENSMUSG00000074653
AA Change: L194Q

DomainStartEndE-ValueType
LRR 92 119 4.4e-2 SMART
Blast:LRR 148 175 2e-8 BLAST
LRR 176 203 2.5e-1 SMART
LRR 204 231 6.5e-2 SMART
LRR 260 287 9.9e-2 SMART
Pfam:LRR_6 288 307 8.2e-1 PFAM
LRR 372 399 8e-3 SMART
LRR 402 430 2.7e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133653
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik G T 2: 104,123,330 probably null Het
Abca14 T C 7: 120,207,434 L19P probably damaging Het
Abcb1a T A 5: 8,713,281 V603E probably damaging Het
Acsl5 A G 19: 55,272,806 D65G probably benign Het
Acss3 T C 10: 107,023,912 Y311C probably damaging Het
Ak8 T G 2: 28,733,856 I151S possibly damaging Het
Aldh1a1 T C 19: 20,629,049 probably benign Het
Aldh1l1 A G 6: 90,569,893 R393G possibly damaging Het
Ankhd1 T A 18: 36,634,300 L1164Q probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atf5 A G 7: 44,813,397 M101T possibly damaging Het
C77080 A G 4: 129,223,684 S396P probably damaging Het
Det1 T C 7: 78,844,017 T80A probably benign Het
Dpp9 C T 17: 56,194,404 probably benign Het
Fam13c A G 10: 70,534,761 R244G probably damaging Het
Fat3 A T 9: 16,246,896 N1139K probably damaging Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fli1 T C 9: 32,452,129 probably benign Het
Glb1l2 T G 9: 26,794,101 D151A probably damaging Het
Gli2 G A 1: 118,840,490 T669I possibly damaging Het
Igsf3 C A 3: 101,435,435 R463S probably damaging Het
Il1rl2 T C 1: 40,326,502 V3A unknown Het
Irx3 G A 8: 91,800,080 S332F probably benign Het
Katnb1 C T 8: 95,095,658 T303M possibly damaging Het
Lrrc37a T G 11: 103,503,438 E387A probably benign Het
Mapk14 T C 17: 28,691,789 I17T probably benign Het
Mtif2 A G 11: 29,533,401 probably benign Het
Myo16 A G 8: 10,569,918 T1490A probably benign Het
Nfasc A G 1: 132,611,595 V399A probably damaging Het
Nobox T C 6: 43,307,235 K1E probably null Het
Nr2c1 A T 10: 94,181,512 M371L probably benign Het
Olfr1330 C T 4: 118,893,251 T56I possibly damaging Het
Olfr642 G A 7: 104,049,772 T194I probably benign Het
Oplah C T 15: 76,298,487 R924H probably benign Het
Pappa2 C A 1: 158,716,990 C1756F probably damaging Het
Pdzd8 G A 19: 59,300,929 R680C probably damaging Het
Rassf3 G A 10: 121,417,170 T44M probably benign Het
Rmnd1 T C 10: 4,427,693 probably null Het
Rnf126 C T 10: 79,762,643 probably benign Het
Rnf144b T C 13: 47,244,490 S299P probably benign Het
Ryr2 A G 13: 11,834,095 probably benign Het
Scel T A 14: 103,603,254 S511T probably benign Het
Slc16a10 G T 10: 40,040,631 S138* probably null Het
Slc36a4 A T 9: 15,734,266 I330F probably damaging Het
Slc5a8 A G 10: 88,886,558 I84M probably benign Het
Spag9 T C 11: 94,091,753 probably benign Het
Suco C T 1: 161,834,850 V671I probably benign Het
Suox G A 10: 128,670,885 P425S probably damaging Het
Tmem266 T A 9: 55,437,413 V443E probably benign Het
Tmprss11f A T 5: 86,557,011 I16N probably benign Het
Tnik T A 3: 28,570,880 Y321* probably null Het
Tnrc6b T C 15: 80,913,323 M1357T probably benign Het
Tpbg C A 9: 85,844,750 Y257* probably null Het
Usp37 A T 1: 74,490,107 S138T probably benign Het
Veph1 T A 3: 66,255,028 R70* probably null Het
Vmn2r17 C T 5: 109,452,881 P682S probably damaging Het
Vmn2r79 A C 7: 87,002,403 N337H probably benign Het
Vstm2b A G 7: 40,902,452 D68G probably damaging Het
Vwa7 G T 17: 35,017,957 A167S possibly damaging Het
Zfp647 A T 15: 76,911,386 I358N probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Lrrc31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03110:Lrrc31 APN 3 30679266 missense probably benign 0.04
R0285:Lrrc31 UTSW 3 30684948 missense probably benign 0.02
R0348:Lrrc31 UTSW 3 30689228 missense probably benign 0.14
R0453:Lrrc31 UTSW 3 30687525 missense probably damaging 1.00
R0613:Lrrc31 UTSW 3 30685035 splice site probably benign
R2243:Lrrc31 UTSW 3 30685030 splice site probably benign
R2248:Lrrc31 UTSW 3 30689901 missense possibly damaging 0.95
R4093:Lrrc31 UTSW 3 30695522 missense probably damaging 1.00
R4781:Lrrc31 UTSW 3 30687377 intron probably benign
R4805:Lrrc31 UTSW 3 30691297 nonsense probably null
R4835:Lrrc31 UTSW 3 30679157 missense probably damaging 0.97
R4893:Lrrc31 UTSW 3 30679297 missense probably benign 0.02
R4936:Lrrc31 UTSW 3 30689268 missense probably damaging 1.00
R5063:Lrrc31 UTSW 3 30689936 missense possibly damaging 0.78
R5135:Lrrc31 UTSW 3 30684890 nonsense probably null
R5527:Lrrc31 UTSW 3 30691228 missense probably damaging 1.00
R5607:Lrrc31 UTSW 3 30689845 splice site probably null
R5608:Lrrc31 UTSW 3 30689845 splice site probably null
R5611:Lrrc31 UTSW 3 30691155 critical splice donor site probably null
R5865:Lrrc31 UTSW 3 30679140 missense probably benign 0.01
R6001:Lrrc31 UTSW 3 30691169 missense possibly damaging 0.68
X0027:Lrrc31 UTSW 3 30689279 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCGCCAACCCTGATATATGCTGC -3'
(R):5'- ACATAGGAAAGTTGCCTGGAGTGC -3'

Sequencing Primer
(F):5'- GGAACGCAACTTCAGTTCCT -3'
(R):5'- tcccgccttctattctaccc -3'
Posted On2013-05-09