Incidental Mutation 'R4791:Fsip2'
ID368535
Institutional Source Beutler Lab
Gene Symbol Fsip2
Ensembl Gene ENSMUSG00000075249
Gene Namefibrous sheath-interacting protein 2
SynonymsOTTMUSG00000013335
MMRRC Submission 041976-MU
Accession Numbers

Genbank: XM_913669; MGI: 2664111

Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R4791 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location82943634-83008937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82982108 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2924 (T2924A)
Ref Sequence ENSEMBL: ENSMUSP00000120314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143764]
Predicted Effect unknown
Transcript: ENSMUST00000132967
AA Change: T438A
SMART Domains Protein: ENSMUSP00000122350
Gene: ENSMUSG00000075249
AA Change: T438A

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
low complexity region 953 962 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143764
AA Change: T2924A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120314
Gene: ENSMUSG00000075249
AA Change: T2924A

DomainStartEndE-ValueType
coiled coil region 271 297 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1115 1120 N/A INTRINSIC
low complexity region 1531 1545 N/A INTRINSIC
low complexity region 2044 2057 N/A INTRINSIC
low complexity region 2507 2523 N/A INTRINSIC
low complexity region 2564 2575 N/A INTRINSIC
low complexity region 2866 2877 N/A INTRINSIC
low complexity region 2896 2915 N/A INTRINSIC
low complexity region 3220 3231 N/A INTRINSIC
low complexity region 3438 3447 N/A INTRINSIC
Pfam:FSIP2 4045 4408 3.5e-42 PFAM
Pfam:FSIP2 4375 4613 7.7e-26 PFAM
Pfam:FSIP2 4622 4932 4.3e-17 PFAM
Pfam:FSIP2 4903 5454 7e-27 PFAM
low complexity region 5507 5522 N/A INTRINSIC
low complexity region 5769 5780 N/A INTRINSIC
low complexity region 5834 5846 N/A INTRINSIC
low complexity region 5851 5867 N/A INTRINSIC
Pfam:FSIP2 5998 6867 N/A PFAM
low complexity region 6977 6990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the sperm fibrous sheath. Genes encoding most of the fibrous-sheath associated proteins genes are transcribed only during the postmeiotic period of spermatogenesis. The protein encoded by this gene is specific to spermatogenic cells. Copy number variation in this gene may be associated with testicular germ cell tumors. Pseudogenes associated with this gene are reported on chromosomes 2 and X. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G T 6: 50,595,837 P32Q probably damaging Het
Abcc6 C T 7: 45,982,160 V1231M probably benign Het
Agl A G 3: 116,786,528 probably null Het
Ak7 T C 12: 105,710,145 F35L probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Arhgef5 C T 6: 43,283,183 L1368F probably damaging Het
Atp5j2 T C 5: 145,184,555 Y72C possibly damaging Het
Atp6v0a2 T G 5: 124,646,727 F317V probably benign Het
Bank1 A T 3: 136,254,929 S56T probably benign Het
BC080695 A G 4: 143,570,989 probably benign Het
Cachd1 T A 4: 100,918,085 C166S probably damaging Het
Cand1 A G 10: 119,210,702 I961T probably benign Het
Ccdc73 G A 2: 104,981,105 probably null Het
Cct6b A T 11: 82,742,004 probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Col6a4 A T 9: 106,080,202 V141E possibly damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cr2 A T 1: 195,155,935 C698S probably damaging Het
Diexf G A 1: 193,128,267 H143Y probably benign Het
Dnaaf5 C A 5: 139,184,650 Q786K possibly damaging Het
Dnah6 T C 6: 73,095,074 D2423G probably benign Het
Dnhd1 T C 7: 105,721,117 F4583S probably damaging Het
Duoxa2 A T 2: 122,301,198 T123S probably damaging Het
Edem1 T G 6: 108,841,634 V201G probably damaging Het
Eef1d C T 15: 75,903,682 A43T possibly damaging Het
Elavl3 T C 9: 22,024,678 K249E probably damaging Het
Epg5 G T 18: 77,948,996 E303* probably null Het
Fam83h T C 15: 76,002,368 D1040G probably damaging Het
Fndc7 A T 3: 108,876,659 F211L probably benign Het
Gm5616 T C 9: 48,450,683 noncoding transcript Het
Gpr135 T A 12: 72,069,868 D375V probably benign Het
Hgd A G 16: 37,631,825 *446W probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Htra2 A G 6: 83,051,817 L379P probably damaging Het
Hypk G T 2: 121,457,655 probably null Het
Ica1l A G 1: 60,010,201 F198L probably damaging Het
Igsf11 G A 16: 39,024,864 S319N probably damaging Het
Il12rb1 T C 8: 70,813,368 S213P possibly damaging Het
Katnal1 C T 5: 148,904,650 V135M probably damaging Het
Kcnc4 G A 3: 107,447,543 P530S probably benign Het
Kcnu1 T C 8: 25,913,752 Y24H probably damaging Het
Kdm5b A G 1: 134,630,800 E1515G possibly damaging Het
Kif18a A T 2: 109,287,875 M12L probably benign Het
Klre1 T C 6: 129,584,155 S160P probably damaging Het
Lama2 A T 10: 27,467,271 H68Q probably damaging Het
Lgals8 T C 13: 12,453,322 K49R possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lsr T C 7: 30,958,552 T328A probably damaging Het
Mark4 C T 7: 19,451,657 E51K probably benign Het
Mindy2 T C 9: 70,634,001 probably null Het
Mkks G A 2: 136,876,162 T400I probably benign Het
Mon2 T A 10: 123,006,057 M1544L probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo5c T G 9: 75,290,916 L1341R probably damaging Het
Nin T C 12: 70,043,807 R945G possibly damaging Het
Nox4 T C 7: 87,304,847 V120A probably benign Het
Olfr1196 C T 2: 88,700,898 V144I probably benign Het
Olfr1496 T A 19: 13,781,342 C243* probably null Het
Olfr169 G T 16: 19,566,663 H73Q possibly damaging Het
Olfr30 A T 11: 58,455,544 V135E possibly damaging Het
Olfr847 T C 9: 19,375,809 E24G probably benign Het
Plekha2 T A 8: 25,042,762 R398W probably damaging Het
Pradc1 A G 6: 85,447,191 W58R probably damaging Het
Prrc2b A G 2: 32,217,339 probably null Het
Psg19 T A 7: 18,794,146 N224I probably damaging Het
Ranbp17 A C 11: 33,487,746 V164G probably benign Het
Rasgrp3 A G 17: 75,500,173 S211G probably benign Het
Rcc1l G A 5: 134,163,776 P270S possibly damaging Het
Rfx6 T A 10: 51,719,944 probably null Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Selenof T G 3: 144,596,823 Y120D probably damaging Het
Sema3b G T 9: 107,603,813 D108E probably damaging Het
Shank3 T A 15: 89,500,354 L143Q probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sirt4 T C 5: 115,480,314 T234A possibly damaging Het
Slc25a30 C A 14: 75,763,366 W266L probably benign Het
Spata20 A T 11: 94,484,586 N127K probably damaging Het
St14 C T 9: 31,095,622 G636D probably benign Het
Stat5a G A 11: 100,865,463 E170K probably damaging Het
Sugp2 C T 8: 70,242,790 R138C probably damaging Het
Sult1e1 C A 5: 87,586,730 W119L possibly damaging Het
Sv2a T C 3: 96,192,558 V608A possibly damaging Het
Syne2 T C 12: 75,909,244 Y575H possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Thoc6 T C 17: 23,670,067 H151R possibly damaging Het
Tm9sf2 T C 14: 122,139,650 S197P probably benign Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tmx2 G A 2: 84,677,996 P15L probably damaging Het
Top1mt C T 15: 75,668,625 probably null Het
Trpm6 T A 19: 18,867,981 S1682T probably benign Het
Trrap C T 5: 144,803,277 R1171W probably damaging Het
Ugt3a2 A G 15: 9,361,579 D147G probably damaging Het
Vnn3 A G 10: 23,864,621 H274R probably benign Het
Vwf C A 6: 125,643,363 T1668K Het
Zfp568 T C 7: 30,015,183 S162P probably damaging Het
Zfp658 T A 7: 43,574,466 C722S possibly damaging Het
Zfp808 T A 13: 62,171,231 H91Q probably damaging Het
Other mutations in Fsip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Fsip2 APN 2 82990386 missense probably benign 0.18
IGL00557:Fsip2 APN 2 82991313 missense possibly damaging 0.53
IGL01343:Fsip2 APN 2 82999819 missense possibly damaging 0.53
IGL01387:Fsip2 APN 2 82992982 missense possibly damaging 0.71
IGL01523:Fsip2 APN 2 82977519 missense probably benign
IGL01554:Fsip2 APN 2 82977278 missense possibly damaging 0.68
IGL01650:Fsip2 APN 2 82991086 missense probably benign 0.33
IGL01809:Fsip2 APN 2 82978347 missense possibly damaging 0.80
IGL01826:Fsip2 APN 2 82982639 missense probably benign 0.18
IGL01830:Fsip2 APN 2 82984929 missense probably benign
IGL01918:Fsip2 APN 2 82992138 missense possibly damaging 0.71
IGL01932:Fsip2 APN 2 82994005 missense possibly damaging 0.71
IGL01989:Fsip2 APN 2 82993867 missense probably damaging 0.99
IGL02096:Fsip2 APN 2 82991860 missense possibly damaging 0.85
IGL02153:Fsip2 APN 2 82978721 missense probably benign
IGL02155:Fsip2 APN 2 82998352 missense probably benign
IGL02219:Fsip2 APN 2 82977830 missense probably benign 0.07
IGL02248:Fsip2 APN 2 82982772 missense possibly damaging 0.73
IGL02316:Fsip2 APN 2 82978793 missense probably benign
IGL02478:Fsip2 APN 2 82984392 missense probably benign 0.00
IGL02504:Fsip2 APN 2 82978855 missense possibly damaging 0.83
IGL02572:Fsip2 APN 2 82992003 missense probably benign 0.32
IGL02625:Fsip2 APN 2 82949492 missense probably benign 0.00
IGL02665:Fsip2 APN 2 82993063 missense probably damaging 1.00
IGL02668:Fsip2 APN 2 82998318 missense probably benign 0.06
IGL02676:Fsip2 APN 2 82982157 missense possibly damaging 0.53
IGL02717:Fsip2 APN 2 82951026 splice site probably benign
IGL02805:Fsip2 APN 2 82993495 missense probably benign 0.01
IGL02943:Fsip2 APN 2 82992357 missense probably benign 0.32
IGL02965:Fsip2 APN 2 82983054 missense probably benign 0.33
IGL03001:Fsip2 APN 2 82990624 intron probably benign
IGL03076:Fsip2 APN 2 82982138 missense possibly damaging 0.96
IGL03229:Fsip2 APN 2 82978076 missense possibly damaging 0.86
IGL03353:Fsip2 APN 2 82977393 missense possibly damaging 0.85
IGL03401:Fsip2 APN 2 82990470 missense probably benign
engulf UTSW 2 82984776 missense probably damaging 0.98
envelope UTSW 2 82980741 missense probably benign 0.07
glove UTSW 2 82978394 missense possibly damaging 0.85
swaddle UTSW 2 82983428 missense possibly damaging 0.93
wrap UTSW 2 82986820 missense probably benign 0.04
wrapper UTSW 2 82990086 missense possibly damaging 0.71
D4186:Fsip2 UTSW 2 82988412 missense probably benign 0.32
FR4976:Fsip2 UTSW 2 82984362 critical splice acceptor site probably benign
FR4976:Fsip2 UTSW 2 82984365 critical splice acceptor site probably benign
PIT4382001:Fsip2 UTSW 2 82990852 missense possibly damaging 0.86
R0017:Fsip2 UTSW 2 82992072 missense probably damaging 0.98
R0017:Fsip2 UTSW 2 82992072 missense probably damaging 0.98
R0021:Fsip2 UTSW 2 82999857 splice site probably benign
R0054:Fsip2 UTSW 2 82986955 missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82976608 missense probably damaging 0.96
R0054:Fsip2 UTSW 2 82986955 missense possibly damaging 0.85
R0104:Fsip2 UTSW 2 82978973 missense possibly damaging 0.91
R0104:Fsip2 UTSW 2 82978973 missense possibly damaging 0.91
R0127:Fsip2 UTSW 2 82984925 missense probably benign 0.28
R0131:Fsip2 UTSW 2 82991121 missense probably benign
R0149:Fsip2 UTSW 2 82975505 missense possibly damaging 0.93
R0167:Fsip2 UTSW 2 82980807 missense possibly damaging 0.53
R0190:Fsip2 UTSW 2 82985177 missense possibly damaging 0.73
R0323:Fsip2 UTSW 2 82985896 missense probably benign 0.33
R0358:Fsip2 UTSW 2 82983333 missense possibly damaging 0.56
R0361:Fsip2 UTSW 2 82975505 missense possibly damaging 0.93
R0369:Fsip2 UTSW 2 82984564 missense probably benign 0.33
R0394:Fsip2 UTSW 2 82991075 missense possibly damaging 0.70
R0532:Fsip2 UTSW 2 82977785 missense probably benign 0.33
R0595:Fsip2 UTSW 2 82946952 missense probably damaging 0.99
R0613:Fsip2 UTSW 2 82993795 missense probably damaging 0.99
R0614:Fsip2 UTSW 2 82977533 missense probably benign 0.15
R0619:Fsip2 UTSW 2 82944140 missense probably damaging 1.00
R0626:Fsip2 UTSW 2 82988958 missense probably benign 0.06
R0644:Fsip2 UTSW 2 82976897 missense probably benign 0.02
R0661:Fsip2 UTSW 2 82986169 missense possibly damaging 0.92
R0680:Fsip2 UTSW 2 82991359 missense possibly damaging 0.73
R0688:Fsip2 UTSW 2 82982339 missense probably benign 0.18
R0881:Fsip2 UTSW 2 82986273 missense possibly damaging 0.52
R0919:Fsip2 UTSW 2 82985484 missense possibly damaging 0.53
R0973:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0973:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0974:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0976:Fsip2 UTSW 2 82998031 missense possibly damaging 0.92
R1025:Fsip2 UTSW 2 82989436 nonsense probably null
R1026:Fsip2 UTSW 2 82988461 missense possibly damaging 0.52
R1140:Fsip2 UTSW 2 82975034 missense probably damaging 0.99
R1170:Fsip2 UTSW 2 82991500 missense possibly damaging 0.72
R1180:Fsip2 UTSW 2 82975226 missense probably damaging 0.99
R1188:Fsip2 UTSW 2 82975017 missense possibly damaging 0.96
R1226:Fsip2 UTSW 2 82981011 missense probably damaging 0.96
R1248:Fsip2 UTSW 2 82989763 missense possibly damaging 0.93
R1273:Fsip2 UTSW 2 82989408 missense possibly damaging 0.92
R1323:Fsip2 UTSW 2 82985752 missense probably damaging 1.00
R1323:Fsip2 UTSW 2 82985752 missense probably damaging 1.00
R1356:Fsip2 UTSW 2 82989745 missense probably benign 0.38
R1413:Fsip2 UTSW 2 82988418 missense possibly damaging 0.93
R1430:Fsip2 UTSW 2 82998063 missense possibly damaging 0.71
R1475:Fsip2 UTSW 2 82987195 missense probably damaging 0.99
R1489:Fsip2 UTSW 2 82979811 missense probably benign
R1520:Fsip2 UTSW 2 82980714 missense possibly damaging 0.96
R1543:Fsip2 UTSW 2 82981587 missense possibly damaging 0.91
R1581:Fsip2 UTSW 2 82986282 missense probably damaging 0.98
R1590:Fsip2 UTSW 2 82982787 missense probably benign 0.26
R1646:Fsip2 UTSW 2 82978517 missense probably benign 0.07
R1678:Fsip2 UTSW 2 82986345 missense probably benign
R1700:Fsip2 UTSW 2 82991737 missense probably benign 0.33
R1717:Fsip2 UTSW 2 82974945 missense possibly damaging 0.68
R1741:Fsip2 UTSW 2 82989912 missense probably benign 0.32
R1760:Fsip2 UTSW 2 82984896 missense probably benign 0.07
R1760:Fsip2 UTSW 2 82987711 missense possibly damaging 0.71
R1760:Fsip2 UTSW 2 82999841 missense possibly damaging 0.85
R1789:Fsip2 UTSW 2 82977562 missense probably benign 0.00
R1850:Fsip2 UTSW 2 82984589 missense possibly damaging 0.72
R1854:Fsip2 UTSW 2 82993257 missense possibly damaging 0.84
R1888:Fsip2 UTSW 2 82944160 missense probably benign 0.04
R1888:Fsip2 UTSW 2 82944160 missense probably benign 0.04
R1905:Fsip2 UTSW 2 82983428 missense possibly damaging 0.93
R1907:Fsip2 UTSW 2 82983428 missense possibly damaging 0.93
R1920:Fsip2 UTSW 2 82986820 missense probably benign 0.04
R1921:Fsip2 UTSW 2 82980783 nonsense probably null
R1921:Fsip2 UTSW 2 82986820 missense probably benign 0.04
R1931:Fsip2 UTSW 2 82986733 missense probably damaging 0.99
R1934:Fsip2 UTSW 2 82980558 missense possibly damaging 0.91
R1959:Fsip2 UTSW 2 82991550 missense probably benign
R1965:Fsip2 UTSW 2 82992780 missense possibly damaging 0.86
R1966:Fsip2 UTSW 2 82992780 missense possibly damaging 0.86
R1983:Fsip2 UTSW 2 82979831 missense probably benign
R1988:Fsip2 UTSW 2 82976517 missense possibly damaging 0.56
R2016:Fsip2 UTSW 2 82982732 missense possibly damaging 0.53
R2017:Fsip2 UTSW 2 82982732 missense possibly damaging 0.53
R2026:Fsip2 UTSW 2 82989444 missense possibly damaging 0.71
R2034:Fsip2 UTSW 2 82989494 missense probably benign 0.43
R2037:Fsip2 UTSW 2 82978512 missense probably damaging 0.99
R2070:Fsip2 UTSW 2 82976355 missense probably damaging 0.98
R2072:Fsip2 UTSW 2 83008815 missense possibly damaging 0.53
R2075:Fsip2 UTSW 2 82988579 missense possibly damaging 0.85
R2143:Fsip2 UTSW 2 82990271 missense possibly damaging 0.93
R2207:Fsip2 UTSW 2 82977479 missense probably benign 0.02
R2256:Fsip2 UTSW 2 82962751 missense probably benign 0.07
R2315:Fsip2 UTSW 2 82975093 missense probably benign
R2344:Fsip2 UTSW 2 82989913 missense possibly damaging 0.71
R2377:Fsip2 UTSW 2 82976249 missense probably benign 0.29
R2403:Fsip2 UTSW 2 82980720 missense possibly damaging 0.53
R2441:Fsip2 UTSW 2 82985341 missense possibly damaging 0.53
R2504:Fsip2 UTSW 2 82979610 missense possibly damaging 0.86
R2510:Fsip2 UTSW 2 82986438 missense probably benign
R2511:Fsip2 UTSW 2 82951657 missense probably damaging 1.00
R2511:Fsip2 UTSW 2 82986438 missense probably benign
R2512:Fsip2 UTSW 2 82978167 missense probably benign 0.04
R2568:Fsip2 UTSW 2 82990431 missense probably benign 0.14
R2656:Fsip2 UTSW 2 82979045 missense possibly damaging 0.83
R2883:Fsip2 UTSW 2 82991524 missense possibly damaging 0.86
R3417:Fsip2 UTSW 2 82986510 missense possibly damaging 0.51
R3431:Fsip2 UTSW 2 82992010 missense possibly damaging 0.85
R3441:Fsip2 UTSW 2 82986727 missense probably benign 0.00
R3605:Fsip2 UTSW 2 82984909 missense probably benign 0.28
R3620:Fsip2 UTSW 2 82980258 missense probably benign 0.00
R3621:Fsip2 UTSW 2 82980258 missense probably benign 0.00
R3726:Fsip2 UTSW 2 82988967 missense possibly damaging 0.84
R3755:Fsip2 UTSW 2 82978217 missense probably benign 0.26
R3789:Fsip2 UTSW 2 82982714 missense probably damaging 0.96
R3836:Fsip2 UTSW 2 82950946 missense probably damaging 1.00
R3844:Fsip2 UTSW 2 82989606 missense possibly damaging 0.52
R3846:Fsip2 UTSW 2 82986415 missense possibly damaging 0.52
R3861:Fsip2 UTSW 2 82984776 missense probably damaging 0.98
R3981:Fsip2 UTSW 2 82958662 missense probably benign 0.08
R4014:Fsip2 UTSW 2 82983518 missense probably benign
R4042:Fsip2 UTSW 2 82983552 missense probably benign 0.02
R4075:Fsip2 UTSW 2 82982901 missense probably benign 0.26
R4154:Fsip2 UTSW 2 82987069 missense possibly damaging 0.71
R4210:Fsip2 UTSW 2 82975149 missense probably damaging 0.99
R4211:Fsip2 UTSW 2 82975149 missense probably damaging 0.99
R4327:Fsip2 UTSW 2 82987059 missense probably benign 0.25
R4332:Fsip2 UTSW 2 82977857 missense probably benign 0.00
R4440:Fsip2 UTSW 2 82991206 missense possibly damaging 0.85
R4454:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4455:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4457:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4458:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4540:Fsip2 UTSW 2 82951665 missense probably benign
R4549:Fsip2 UTSW 2 82989628 missense probably damaging 0.99
R4558:Fsip2 UTSW 2 82984953 missense possibly damaging 0.73
R4573:Fsip2 UTSW 2 82986166 missense possibly damaging 0.71
R4583:Fsip2 UTSW 2 82978673 missense probably benign 0.33
R4618:Fsip2 UTSW 2 82987759 missense probably benign
R4700:Fsip2 UTSW 2 82987029 missense probably benign 0.32
R4716:Fsip2 UTSW 2 82974859 missense probably damaging 0.96
R4739:Fsip2 UTSW 2 82975353 missense possibly damaging 0.92
R4749:Fsip2 UTSW 2 82989285 missense probably benign 0.06
R4793:Fsip2 UTSW 2 82987700 nonsense probably null
R4819:Fsip2 UTSW 2 82988442 missense probably benign 0.06
R4832:Fsip2 UTSW 2 82990171 missense possibly damaging 0.92
R4840:Fsip2 UTSW 2 82949395 missense probably benign 0.01
R4840:Fsip2 UTSW 2 82985471 missense probably benign 0.26
R4865:Fsip2 UTSW 2 82990951 missense possibly damaging 0.86
R4876:Fsip2 UTSW 2 82974858 missense possibly damaging 0.91
R4885:Fsip2 UTSW 2 82988094 missense probably benign 0.02
R4911:Fsip2 UTSW 2 82981493 missense possibly damaging 0.85
R4918:Fsip2 UTSW 2 82993770 missense possibly damaging 0.51
R4936:Fsip2 UTSW 2 82985040 missense probably benign 0.18
R4950:Fsip2 UTSW 2 82946932 missense probably damaging 0.97
R4950:Fsip2 UTSW 2 82977414 missense probably benign 0.03
R4959:Fsip2 UTSW 2 82984825 missense probably benign 0.00
R4971:Fsip2 UTSW 2 82985878 missense probably benign 0.38
R4973:Fsip2 UTSW 2 82984825 missense probably benign 0.00
R4976:Fsip2 UTSW 2 82988191 missense probably damaging 0.99
R5022:Fsip2 UTSW 2 82979429 missense probably benign 0.33
R5027:Fsip2 UTSW 2 82989133 missense possibly damaging 0.71
R5030:Fsip2 UTSW 2 82988492 missense possibly damaging 0.85
R5048:Fsip2 UTSW 2 82993150 missense probably damaging 0.97
R5096:Fsip2 UTSW 2 82991116 missense probably benign 0.00
R5097:Fsip2 UTSW 2 82991985 missense probably benign
R5119:Fsip2 UTSW 2 82988191 missense probably damaging 0.99
R5138:Fsip2 UTSW 2 82981424 missense probably benign 0.12
R5152:Fsip2 UTSW 2 82978572 missense probably benign 0.43
R5174:Fsip2 UTSW 2 82980741 missense probably benign 0.07
R5193:Fsip2 UTSW 2 82982994 missense possibly damaging 0.53
R5245:Fsip2 UTSW 2 82993161 missense probably benign 0.02
R5282:Fsip2 UTSW 2 82978581 missense possibly damaging 0.61
R5323:Fsip2 UTSW 2 82988145 missense possibly damaging 0.71
R5326:Fsip2 UTSW 2 82981863 missense possibly damaging 0.84
R5378:Fsip2 UTSW 2 82989841 missense possibly damaging 0.71
R5380:Fsip2 UTSW 2 82975398 missense possibly damaging 0.91
R5396:Fsip2 UTSW 2 82990918 missense probably benign 0.00
R5422:Fsip2 UTSW 2 82982228 missense probably benign 0.00
R5481:Fsip2 UTSW 2 82979886 missense probably benign 0.26
R5482:Fsip2 UTSW 2 82985310 missense possibly damaging 0.80
R5513:Fsip2 UTSW 2 82950908 missense probably damaging 1.00
R5513:Fsip2 UTSW 2 82950912 missense probably benign 0.07
R5513:Fsip2 UTSW 2 82985198 missense possibly damaging 0.72
R5536:Fsip2 UTSW 2 82987059 missense probably benign 0.25
R5542:Fsip2 UTSW 2 82981863 missense possibly damaging 0.84
R5553:Fsip2 UTSW 2 82962746 missense probably benign
R5568:Fsip2 UTSW 2 82986564 missense probably benign 0.25
R5581:Fsip2 UTSW 2 82998128 missense possibly damaging 0.84
R5664:Fsip2 UTSW 2 82988095 missense probably benign 0.05
R5672:Fsip2 UTSW 2 82987494 nonsense probably null
R5712:Fsip2 UTSW 2 83008848 missense possibly damaging 0.73
R5762:Fsip2 UTSW 2 82977916 missense probably benign 0.33
R5772:Fsip2 UTSW 2 82984740 missense probably benign
R5881:Fsip2 UTSW 2 82984441 missense possibly damaging 0.72
R5919:Fsip2 UTSW 2 82992609 missense possibly damaging 0.71
R5920:Fsip2 UTSW 2 82988508 nonsense probably null
R5934:Fsip2 UTSW 2 82986748 missense possibly damaging 0.86
R5938:Fsip2 UTSW 2 82977491 missense probably benign 0.00
R5974:Fsip2 UTSW 2 82963313 missense possibly damaging 0.68
R5991:Fsip2 UTSW 2 82990468 missense probably benign 0.28
R6019:Fsip2 UTSW 2 82987939 missense possibly damaging 0.52
R6020:Fsip2 UTSW 2 82992127 missense probably damaging 0.99
R6056:Fsip2 UTSW 2 82985673 missense probably benign 0.01
R6057:Fsip2 UTSW 2 82979433 missense probably damaging 0.99
R6139:Fsip2 UTSW 2 82991044 missense possibly damaging 0.85
R6145:Fsip2 UTSW 2 82993768 missense possibly damaging 0.71
R6160:Fsip2 UTSW 2 82987945 nonsense probably null
R6161:Fsip2 UTSW 2 82987257 missense possibly damaging 0.80
R6166:Fsip2 UTSW 2 82980727 missense probably benign 0.00
R6187:Fsip2 UTSW 2 82982454 missense probably benign 0.33
R6196:Fsip2 UTSW 2 82989883 missense possibly damaging 0.71
R6217:Fsip2 UTSW 2 82988418 missense possibly damaging 0.93
R6276:Fsip2 UTSW 2 82980441 missense possibly damaging 0.91
R6278:Fsip2 UTSW 2 82988898 missense probably benign 0.16
R6349:Fsip2 UTSW 2 82993072 missense probably benign 0.05
R6351:Fsip2 UTSW 2 82992684 missense possibly damaging 0.51
R6401:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6404:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6405:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6437:Fsip2 UTSW 2 82983492 missense possibly damaging 0.73
R6478:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6479:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6480:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6481:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6521:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6529:Fsip2 UTSW 2 82982313 missense probably benign
R6621:Fsip2 UTSW 2 82989814 missense possibly damaging 0.93
R6639:Fsip2 UTSW 2 82983227 missense possibly damaging 0.85
R6649:Fsip2 UTSW 2 82967817 missense possibly damaging 0.83
R6714:Fsip2 UTSW 2 82979534 missense probably benign 0.01
R6714:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6749:Fsip2 UTSW 2 82978394 missense possibly damaging 0.85
R6765:Fsip2 UTSW 2 82986432 missense probably benign
R6790:Fsip2 UTSW 2 82990939 missense possibly damaging 0.53
R6793:Fsip2 UTSW 2 82989494 missense probably benign 0.43
R6795:Fsip2 UTSW 2 82980959 missense probably benign 0.08
R6818:Fsip2 UTSW 2 82985200 missense probably benign 0.04
R6844:Fsip2 UTSW 2 82983625 missense possibly damaging 0.72
R6848:Fsip2 UTSW 2 82982787 missense probably benign 0.26
R6945:Fsip2 UTSW 2 82992840 missense probably benign 0.16
R6950:Fsip2 UTSW 2 82985988 missense probably benign 0.03
R6951:Fsip2 UTSW 2 82981949 missense possibly damaging 0.68
R6974:Fsip2 UTSW 2 82978717 missense probably damaging 0.96
R6987:Fsip2 UTSW 2 82948286 nonsense probably null
R6989:Fsip2 UTSW 2 82976954 missense probably benign 0.00
R7001:Fsip2 UTSW 2 82986925 missense probably damaging 1.00
R7002:Fsip2 UTSW 2 82989343 missense possibly damaging 0.86
R7016:Fsip2 UTSW 2 82990635 missense probably benign 0.25
R7066:Fsip2 UTSW 2 82990891 missense possibly damaging 0.86
R7067:Fsip2 UTSW 2 82980734 missense possibly damaging 0.85
R7077:Fsip2 UTSW 2 82983152 missense probably benign 0.18
R7099:Fsip2 UTSW 2 82987624 missense probably benign
R7126:Fsip2 UTSW 2 82983141 missense possibly damaging 0.53
R7156:Fsip2 UTSW 2 82982741 missense probably benign 0.00
R7165:Fsip2 UTSW 2 82981197 missense possibly damaging 0.77
R7171:Fsip2 UTSW 2 82986227 nonsense probably null
R7189:Fsip2 UTSW 2 82993237 missense possibly damaging 0.92
R7217:Fsip2 UTSW 2 82989068 missense possibly damaging 0.85
R7222:Fsip2 UTSW 2 82983671 missense probably benign
R7228:Fsip2 UTSW 2 82992307 missense possibly damaging 0.93
R7238:Fsip2 UTSW 2 82982140 missense possibly damaging 0.72
R7244:Fsip2 UTSW 2 82993263 missense possibly damaging 0.92
R7251:Fsip2 UTSW 2 82979081 missense possibly damaging 0.95
R7259:Fsip2 UTSW 2 82982130 missense possibly damaging 0.85
R7291:Fsip2 UTSW 2 82980519 missense possibly damaging 0.91
R7316:Fsip2 UTSW 2 82989691 missense possibly damaging 0.93
R7323:Fsip2 UTSW 2 82989516 missense probably benign 0.07
X0018:Fsip2 UTSW 2 82982507 nonsense probably null
X0020:Fsip2 UTSW 2 82951020 missense probably damaging 1.00
X0025:Fsip2 UTSW 2 82954946 missense possibly damaging 0.70
X0027:Fsip2 UTSW 2 82976778 missense probably benign 0.35
X0066:Fsip2 UTSW 2 82987463 missense possibly damaging 0.51
Z1088:Fsip2 UTSW 2 82975448 missense probably damaging 0.96
Z1088:Fsip2 UTSW 2 82987653 missense possibly damaging 0.86
Z1088:Fsip2 UTSW 2 82988634 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTTATCCTACGGAGCAACCATG -3'
(R):5'- GGAACCCCATGCTTACTCTTGC -3'

Sequencing Primer
(F):5'- CCTCACAGTTAGAACAGATATTTCC -3'
(R):5'- ATGCTTACTCTTGCTGGTACCGTG -3'
Posted On2016-02-04