Incidental Mutation 'R4791:Hypk'
ID368540
Institutional Source Beutler Lab
Gene Symbol Hypk
Ensembl Gene ENSMUSG00000027245
Gene Namehuntingtin interacting protein K
Synonyms2310003F16Rik
MMRRC Submission 041976-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.898) question?
Stock #R4791 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121453290-121458672 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 121457655 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056312] [ENSMUST00000056732] [ENSMUST00000110612] [ENSMUST00000110613] [ENSMUST00000126764] [ENSMUST00000139253] [ENSMUST00000148575] [ENSMUST00000154418]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000028677
Predicted Effect probably null
Transcript: ENSMUST00000056312
SMART Domains Protein: ENSMUSP00000051261
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 33 488 3e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056732
SMART Domains Protein: ENSMUSP00000049548
Gene: ENSMUSG00000048222

DomainStartEndE-ValueType
low complexity region 51 59 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 123 N/A INTRINSIC
coiled coil region 134 150 N/A INTRINSIC
Pfam:MFAP1 190 399 1.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110612
AA Change: V66F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106242
Gene: ENSMUSG00000027245
AA Change: V66F

DomainStartEndE-ValueType
coiled coil region 69 111 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110613
SMART Domains Protein: ENSMUSP00000106243
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 34 280 5.6e-67 PFAM
low complexity region 342 364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126678
Predicted Effect probably benign
Transcript: ENSMUST00000126764
AA Change: V66F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117946
Gene: ENSMUSG00000027245
AA Change: V66F

DomainStartEndE-ValueType
coiled coil region 69 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127435
SMART Domains Protein: ENSMUSP00000119373
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 2 192 7.7e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134412
Predicted Effect probably benign
Transcript: ENSMUST00000139253
SMART Domains Protein: ENSMUSP00000123181
Gene: ENSMUSG00000074884

DomainStartEndE-ValueType
Pfam:4F5 1 38 1e-14 PFAM
low complexity region 45 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140135
SMART Domains Protein: ENSMUSP00000117054
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 1 75 8.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140752
SMART Domains Protein: ENSMUSP00000116676
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 2 78 7.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148575
SMART Domains Protein: ENSMUSP00000121895
Gene: ENSMUSG00000074884

DomainStartEndE-ValueType
Pfam:4F5 1 38 2.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154418
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G T 6: 50,595,837 P32Q probably damaging Het
Abcc6 C T 7: 45,982,160 V1231M probably benign Het
Agl A G 3: 116,786,528 probably null Het
Ak7 T C 12: 105,710,145 F35L probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Arhgef5 C T 6: 43,283,183 L1368F probably damaging Het
Atp5j2 T C 5: 145,184,555 Y72C possibly damaging Het
Atp6v0a2 T G 5: 124,646,727 F317V probably benign Het
Bank1 A T 3: 136,254,929 S56T probably benign Het
BC080695 A G 4: 143,570,989 probably benign Het
Cachd1 T A 4: 100,918,085 C166S probably damaging Het
Cand1 A G 10: 119,210,702 I961T probably benign Het
Ccdc73 G A 2: 104,981,105 probably null Het
Cct6b A T 11: 82,742,004 probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Col6a4 A T 9: 106,080,202 V141E possibly damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cr2 A T 1: 195,155,935 C698S probably damaging Het
Diexf G A 1: 193,128,267 H143Y probably benign Het
Dnaaf5 C A 5: 139,184,650 Q786K possibly damaging Het
Dnah6 T C 6: 73,095,074 D2423G probably benign Het
Dnhd1 T C 7: 105,721,117 F4583S probably damaging Het
Duoxa2 A T 2: 122,301,198 T123S probably damaging Het
Edem1 T G 6: 108,841,634 V201G probably damaging Het
Eef1d C T 15: 75,903,682 A43T possibly damaging Het
Elavl3 T C 9: 22,024,678 K249E probably damaging Het
Epg5 G T 18: 77,948,996 E303* probably null Het
Fam83h T C 15: 76,002,368 D1040G probably damaging Het
Fndc7 A T 3: 108,876,659 F211L probably benign Het
Fsip2 A G 2: 82,982,108 T2924A possibly damaging Het
Gm5616 T C 9: 48,450,683 noncoding transcript Het
Gpr135 T A 12: 72,069,868 D375V probably benign Het
Hgd A G 16: 37,631,825 *446W probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Htra2 A G 6: 83,051,817 L379P probably damaging Het
Ica1l A G 1: 60,010,201 F198L probably damaging Het
Igsf11 G A 16: 39,024,864 S319N probably damaging Het
Il12rb1 T C 8: 70,813,368 S213P possibly damaging Het
Katnal1 C T 5: 148,904,650 V135M probably damaging Het
Kcnc4 G A 3: 107,447,543 P530S probably benign Het
Kcnu1 T C 8: 25,913,752 Y24H probably damaging Het
Kdm5b A G 1: 134,630,800 E1515G possibly damaging Het
Kif18a A T 2: 109,287,875 M12L probably benign Het
Klre1 T C 6: 129,584,155 S160P probably damaging Het
Lama2 A T 10: 27,467,271 H68Q probably damaging Het
Lgals8 T C 13: 12,453,322 K49R possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lsr T C 7: 30,958,552 T328A probably damaging Het
Mark4 C T 7: 19,451,657 E51K probably benign Het
Mindy2 T C 9: 70,634,001 probably null Het
Mkks G A 2: 136,876,162 T400I probably benign Het
Mon2 T A 10: 123,006,057 M1544L probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo5c T G 9: 75,290,916 L1341R probably damaging Het
Nin T C 12: 70,043,807 R945G possibly damaging Het
Nox4 T C 7: 87,304,847 V120A probably benign Het
Olfr1196 C T 2: 88,700,898 V144I probably benign Het
Olfr1496 T A 19: 13,781,342 C243* probably null Het
Olfr169 G T 16: 19,566,663 H73Q possibly damaging Het
Olfr30 A T 11: 58,455,544 V135E possibly damaging Het
Olfr847 T C 9: 19,375,809 E24G probably benign Het
Plekha2 T A 8: 25,042,762 R398W probably damaging Het
Pradc1 A G 6: 85,447,191 W58R probably damaging Het
Prrc2b A G 2: 32,217,339 probably null Het
Psg19 T A 7: 18,794,146 N224I probably damaging Het
Ranbp17 A C 11: 33,487,746 V164G probably benign Het
Rasgrp3 A G 17: 75,500,173 S211G probably benign Het
Rcc1l G A 5: 134,163,776 P270S possibly damaging Het
Rfx6 T A 10: 51,719,944 probably null Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Selenof T G 3: 144,596,823 Y120D probably damaging Het
Sema3b G T 9: 107,603,813 D108E probably damaging Het
Shank3 T A 15: 89,500,354 L143Q probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sirt4 T C 5: 115,480,314 T234A possibly damaging Het
Slc25a30 C A 14: 75,763,366 W266L probably benign Het
Spata20 A T 11: 94,484,586 N127K probably damaging Het
St14 C T 9: 31,095,622 G636D probably benign Het
Stat5a G A 11: 100,865,463 E170K probably damaging Het
Sugp2 C T 8: 70,242,790 R138C probably damaging Het
Sult1e1 C A 5: 87,586,730 W119L possibly damaging Het
Sv2a T C 3: 96,192,558 V608A possibly damaging Het
Syne2 T C 12: 75,909,244 Y575H possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Thoc6 T C 17: 23,670,067 H151R possibly damaging Het
Tm9sf2 T C 14: 122,139,650 S197P probably benign Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tmx2 G A 2: 84,677,996 P15L probably damaging Het
Top1mt C T 15: 75,668,625 probably null Het
Trpm6 T A 19: 18,867,981 S1682T probably benign Het
Trrap C T 5: 144,803,277 R1171W probably damaging Het
Ugt3a2 A G 15: 9,361,579 D147G probably damaging Het
Vnn3 A G 10: 23,864,621 H274R probably benign Het
Vwf C A 6: 125,643,363 T1668K Het
Zfp568 T C 7: 30,015,183 S162P probably damaging Het
Zfp658 T A 7: 43,574,466 C722S possibly damaging Het
Zfp808 T A 13: 62,171,231 H91Q probably damaging Het
Other mutations in Hypk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Hypk APN 2 121457295 splice site probably null
IGL03309:Hypk APN 2 121458192 nonsense probably null
IGL03309:Hypk APN 2 121458193 missense probably damaging 1.00
R2230:Hypk UTSW 2 121457292 critical splice donor site probably null
R3923:Hypk UTSW 2 121458202 missense possibly damaging 0.65
R4060:Hypk UTSW 2 121453679 intron probably benign
R4438:Hypk UTSW 2 121457994 missense probably damaging 0.98
R4551:Hypk UTSW 2 121453480 critical splice donor site probably null
R5075:Hypk UTSW 2 121455630 utr 3 prime probably benign
R7133:Hypk UTSW 2 121453480 critical splice donor site probably null
R7274:Hypk UTSW 2 121454324 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCCTAAATAGATCTCATGTGCAC -3'
(R):5'- ATAAACGCGCCAACTCTTTC -3'

Sequencing Primer
(F):5'- TCTCATGTGCACGAAATTAGGCG -3'
(R):5'- CCCCTGGAGGTTTTACAGTAAG -3'
Posted On2016-02-04