Incidental Mutation 'R4791:Col6a5'
ID368593
Institutional Source Beutler Lab
Gene Symbol Col6a5
Ensembl Gene ENSMUSG00000091345
Gene Namecollagen, type VI, alpha 5
SynonymsGm7455, Col6a5
MMRRC Submission 041976-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R4791 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location105856078-105960643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105930784 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1022 (T1022A)
Ref Sequence ENSEMBL: ENSMUSP00000139398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165165] [ENSMUST00000190193]
Predicted Effect unknown
Transcript: ENSMUST00000165165
AA Change: T1022A
SMART Domains Protein: ENSMUSP00000131146
Gene: ENSMUSG00000091345
AA Change: T1022A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.8e-24 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 2.23e-20 SMART
VWA 472 649 6.84e-39 SMART
VWA 658 834 1.52e-45 SMART
VWA 844 1024 2.44e-44 SMART
VWA 1035 1208 2.95e-20 SMART
Pfam:Collagen 1425 1478 3.3e-8 PFAM
low complexity region 1493 1508 N/A INTRINSIC
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 9.6e-10 PFAM
low complexity region 1711 1730 N/A INTRINSIC
low complexity region 1739 1757 N/A INTRINSIC
VWA 1788 1964 1.99e-17 SMART
VWA 1994 2173 5.98e-21 SMART
VWA 2319 2513 4.4e-19 SMART
Predicted Effect unknown
Transcript: ENSMUST00000190193
AA Change: T1022A
SMART Domains Protein: ENSMUSP00000139398
Gene: ENSMUSG00000091345
AA Change: T1022A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.1e-26 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 1.4e-22 SMART
VWA 472 649 4.4e-41 SMART
VWA 658 834 9.5e-48 SMART
VWA 844 1024 1.6e-46 SMART
VWA 1035 1208 1.9e-22 SMART
Pfam:Collagen 1425 1478 1.2e-6 PFAM
Pfam:Collagen 1457 1530 5.9e-6 PFAM
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 3.6e-8 PFAM
Pfam:Collagen 1631 1691 8.4e-6 PFAM
Pfam:Collagen 1706 1764 6.6e-6 PFAM
VWA 1788 1964 1.2e-19 SMART
VWA 1994 2173 3.7e-23 SMART
VWA 2319 2513 2.8e-21 SMART
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collagen superfamily of proteins. The encoded protein contains multiple von Willebrand factor A-like domains and may interact with the alpha 1 and alpha 2 chains of collagen VI to form the complete collagen VI trimer. Polymorphisms in this gene may be linked to dermal phenotypes, such as eczema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G T 6: 50,595,837 P32Q probably damaging Het
Abcc6 C T 7: 45,982,160 V1231M probably benign Het
Agl A G 3: 116,786,528 probably null Het
Ak7 T C 12: 105,710,145 F35L probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Arhgef5 C T 6: 43,283,183 L1368F probably damaging Het
Atp5j2 T C 5: 145,184,555 Y72C possibly damaging Het
Atp6v0a2 T G 5: 124,646,727 F317V probably benign Het
Bank1 A T 3: 136,254,929 S56T probably benign Het
BC080695 A G 4: 143,570,989 probably benign Het
Cachd1 T A 4: 100,918,085 C166S probably damaging Het
Cand1 A G 10: 119,210,702 I961T probably benign Het
Ccdc73 G A 2: 104,981,105 probably null Het
Cct6b A T 11: 82,742,004 probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Col6a4 A T 9: 106,080,202 V141E possibly damaging Het
Cr2 A T 1: 195,155,935 C698S probably damaging Het
Diexf G A 1: 193,128,267 H143Y probably benign Het
Dnaaf5 C A 5: 139,184,650 Q786K possibly damaging Het
Dnah6 T C 6: 73,095,074 D2423G probably benign Het
Dnhd1 T C 7: 105,721,117 F4583S probably damaging Het
Duoxa2 A T 2: 122,301,198 T123S probably damaging Het
Edem1 T G 6: 108,841,634 V201G probably damaging Het
Eef1d C T 15: 75,903,682 A43T possibly damaging Het
Elavl3 T C 9: 22,024,678 K249E probably damaging Het
Epg5 G T 18: 77,948,996 E303* probably null Het
Fam83h T C 15: 76,002,368 D1040G probably damaging Het
Fndc7 A T 3: 108,876,659 F211L probably benign Het
Fsip2 A G 2: 82,982,108 T2924A possibly damaging Het
Gm5616 T C 9: 48,450,683 noncoding transcript Het
Gpr135 T A 12: 72,069,868 D375V probably benign Het
Hgd A G 16: 37,631,825 *446W probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Htra2 A G 6: 83,051,817 L379P probably damaging Het
Hypk G T 2: 121,457,655 probably null Het
Ica1l A G 1: 60,010,201 F198L probably damaging Het
Igsf11 G A 16: 39,024,864 S319N probably damaging Het
Il12rb1 T C 8: 70,813,368 S213P possibly damaging Het
Katnal1 C T 5: 148,904,650 V135M probably damaging Het
Kcnc4 G A 3: 107,447,543 P530S probably benign Het
Kcnu1 T C 8: 25,913,752 Y24H probably damaging Het
Kdm5b A G 1: 134,630,800 E1515G possibly damaging Het
Kif18a A T 2: 109,287,875 M12L probably benign Het
Klre1 T C 6: 129,584,155 S160P probably damaging Het
Lama2 A T 10: 27,467,271 H68Q probably damaging Het
Lgals8 T C 13: 12,453,322 K49R possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lsr T C 7: 30,958,552 T328A probably damaging Het
Mark4 C T 7: 19,451,657 E51K probably benign Het
Mindy2 T C 9: 70,634,001 probably null Het
Mkks G A 2: 136,876,162 T400I probably benign Het
Mon2 T A 10: 123,006,057 M1544L probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo5c T G 9: 75,290,916 L1341R probably damaging Het
Nin T C 12: 70,043,807 R945G possibly damaging Het
Nox4 T C 7: 87,304,847 V120A probably benign Het
Olfr1196 C T 2: 88,700,898 V144I probably benign Het
Olfr1496 T A 19: 13,781,342 C243* probably null Het
Olfr169 G T 16: 19,566,663 H73Q possibly damaging Het
Olfr30 A T 11: 58,455,544 V135E possibly damaging Het
Olfr847 T C 9: 19,375,809 E24G probably benign Het
Plekha2 T A 8: 25,042,762 R398W probably damaging Het
Pradc1 A G 6: 85,447,191 W58R probably damaging Het
Prrc2b A G 2: 32,217,339 probably null Het
Psg19 T A 7: 18,794,146 N224I probably damaging Het
Ranbp17 A C 11: 33,487,746 V164G probably benign Het
Rasgrp3 A G 17: 75,500,173 S211G probably benign Het
Rcc1l G A 5: 134,163,776 P270S possibly damaging Het
Rfx6 T A 10: 51,719,944 probably null Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Selenof T G 3: 144,596,823 Y120D probably damaging Het
Sema3b G T 9: 107,603,813 D108E probably damaging Het
Shank3 T A 15: 89,500,354 L143Q probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sirt4 T C 5: 115,480,314 T234A possibly damaging Het
Slc25a30 C A 14: 75,763,366 W266L probably benign Het
Spata20 A T 11: 94,484,586 N127K probably damaging Het
St14 C T 9: 31,095,622 G636D probably benign Het
Stat5a G A 11: 100,865,463 E170K probably damaging Het
Sugp2 C T 8: 70,242,790 R138C probably damaging Het
Sult1e1 C A 5: 87,586,730 W119L possibly damaging Het
Sv2a T C 3: 96,192,558 V608A possibly damaging Het
Syne2 T C 12: 75,909,244 Y575H possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Thoc6 T C 17: 23,670,067 H151R possibly damaging Het
Tm9sf2 T C 14: 122,139,650 S197P probably benign Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tmx2 G A 2: 84,677,996 P15L probably damaging Het
Top1mt C T 15: 75,668,625 probably null Het
Trpm6 T A 19: 18,867,981 S1682T probably benign Het
Trrap C T 5: 144,803,277 R1171W probably damaging Het
Ugt3a2 A G 15: 9,361,579 D147G probably damaging Het
Vnn3 A G 10: 23,864,621 H274R probably benign Het
Vwf C A 6: 125,643,363 T1668K unknown Het
Zfp568 T C 7: 30,015,183 S162P probably damaging Het
Zfp658 T A 7: 43,574,466 C722S possibly damaging Het
Zfp808 T A 13: 62,171,231 H91Q probably damaging Het
Other mutations in Col6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Col6a5 APN 9 105882683 missense probably damaging 1.00
IGL01462:Col6a5 APN 9 105946075 missense unknown
IGL01530:Col6a5 APN 9 105915186 splice site probably benign
IGL01717:Col6a5 APN 9 105940273 missense unknown
IGL01859:Col6a5 APN 9 105930961 nonsense probably null
IGL01945:Col6a5 APN 9 105928290 missense unknown
IGL01985:Col6a5 APN 9 105937283 missense unknown
IGL02128:Col6a5 APN 9 105939894 missense unknown
IGL02170:Col6a5 APN 9 105928422 missense unknown
IGL02224:Col6a5 APN 9 105864335 missense probably damaging 1.00
IGL02246:Col6a5 APN 9 105911107 nonsense probably null
IGL02304:Col6a5 APN 9 105928414 missense unknown
IGL02338:Col6a5 APN 9 105878630 missense probably damaging 1.00
IGL02375:Col6a5 APN 9 105906113 missense unknown
IGL02660:Col6a5 APN 9 105936886 missense unknown
IGL02829:Col6a5 APN 9 105934307 missense unknown
IGL02882:Col6a5 APN 9 105934321 missense unknown
IGL02973:Col6a5 APN 9 105925821 missense unknown
IGL03089:Col6a5 APN 9 105933839 missense unknown
IGL03100:Col6a5 APN 9 105937313 missense unknown
IGL03257:Col6a5 APN 9 105881873 missense possibly damaging 0.95
FR4340:Col6a5 UTSW 9 105934174 missense unknown
FR4342:Col6a5 UTSW 9 105934174 missense unknown
FR4589:Col6a5 UTSW 9 105934174 missense unknown
PIT4131001:Col6a5 UTSW 9 105881914 missense probably damaging 0.98
R0147:Col6a5 UTSW 9 105925794 missense unknown
R0549:Col6a5 UTSW 9 105904579 splice site probably benign
R0622:Col6a5 UTSW 9 105925852 missense unknown
R0628:Col6a5 UTSW 9 105912450 splice site probably null
R0635:Col6a5 UTSW 9 105928606 missense unknown
R0644:Col6a5 UTSW 9 105948324 critical splice donor site probably null
R0828:Col6a5 UTSW 9 105862064 critical splice acceptor site probably null
R0972:Col6a5 UTSW 9 105940285 missense unknown
R1065:Col6a5 UTSW 9 105881783 missense probably damaging 0.99
R1142:Col6a5 UTSW 9 105934317 missense unknown
R1169:Col6a5 UTSW 9 105896974 splice site probably null
R1522:Col6a5 UTSW 9 105939994 missense unknown
R1646:Col6a5 UTSW 9 105862749 nonsense probably null
R1719:Col6a5 UTSW 9 105931293 missense unknown
R1759:Col6a5 UTSW 9 105930846 missense unknown
R1780:Col6a5 UTSW 9 105936878 missense unknown
R1812:Col6a5 UTSW 9 105928054 missense unknown
R1838:Col6a5 UTSW 9 105864833 missense probably benign 0.28
R1839:Col6a5 UTSW 9 105864833 missense probably benign 0.28
R1863:Col6a5 UTSW 9 105940201 missense unknown
R1900:Col6a5 UTSW 9 105931213 missense unknown
R1951:Col6a5 UTSW 9 105936957 missense unknown
R2024:Col6a5 UTSW 9 105936994 missense unknown
R2126:Col6a5 UTSW 9 105945600 missense unknown
R2319:Col6a5 UTSW 9 105937218 missense unknown
R2344:Col6a5 UTSW 9 105928537 missense unknown
R2483:Col6a5 UTSW 9 105864148 missense probably damaging 1.00
R3176:Col6a5 UTSW 9 105911107 nonsense probably null
R3276:Col6a5 UTSW 9 105911107 nonsense probably null
R3438:Col6a5 UTSW 9 105875792 missense possibly damaging 0.88
R3791:Col6a5 UTSW 9 105864669 missense probably damaging 0.99
R3840:Col6a5 UTSW 9 105928611 missense unknown
R3886:Col6a5 UTSW 9 105930930 missense unknown
R3941:Col6a5 UTSW 9 105939834 missense unknown
R4194:Col6a5 UTSW 9 105945914 missense unknown
R4399:Col6a5 UTSW 9 105888965 missense possibly damaging 0.75
R4421:Col6a5 UTSW 9 105928473 missense unknown
R4450:Col6a5 UTSW 9 105904521 missense unknown
R4491:Col6a5 UTSW 9 105940012 missense unknown
R4582:Col6a5 UTSW 9 105862764 missense probably benign 0.17
R4693:Col6a5 UTSW 9 105937172 missense unknown
R4787:Col6a5 UTSW 9 105931081 missense unknown
R4789:Col6a5 UTSW 9 105937335 missense unknown
R4792:Col6a5 UTSW 9 105930784 missense unknown
R4817:Col6a5 UTSW 9 105934298 missense unknown
R4854:Col6a5 UTSW 9 105898751 missense probably benign 0.18
R4927:Col6a5 UTSW 9 105933964 missense unknown
R4969:Col6a5 UTSW 9 105864607 missense probably damaging 1.00
R5037:Col6a5 UTSW 9 105928138 missense unknown
R5118:Col6a5 UTSW 9 105937005 missense unknown
R5144:Col6a5 UTSW 9 105889283 missense probably damaging 1.00
R5145:Col6a5 UTSW 9 105934245 missense unknown
R5160:Col6a5 UTSW 9 105931009 missense unknown
R5182:Col6a5 UTSW 9 105857332 nonsense probably null
R5234:Col6a5 UTSW 9 105864205 missense probably damaging 1.00
R5252:Col6a5 UTSW 9 105940290 missense unknown
R5290:Col6a5 UTSW 9 105946083 missense unknown
R5313:Col6a5 UTSW 9 105945544 missense unknown
R5321:Col6a5 UTSW 9 105928465 missense unknown
R5466:Col6a5 UTSW 9 105931083 missense unknown
R5540:Col6a5 UTSW 9 105862776 missense probably benign 0.44
R5669:Col6a5 UTSW 9 105925998 missense unknown
R5789:Col6a5 UTSW 9 105864608 missense possibly damaging 0.91
R5801:Col6a5 UTSW 9 105948367 missense unknown
R5827:Col6a5 UTSW 9 105928120 nonsense probably null
R5839:Col6a5 UTSW 9 105945393 critical splice donor site probably null
R5908:Col6a5 UTSW 9 105862801 missense possibly damaging 0.88
R5970:Col6a5 UTSW 9 105945847 missense unknown
R6045:Col6a5 UTSW 9 105925918 missense unknown
R6107:Col6a5 UTSW 9 105892272 nonsense probably null
R6168:Col6a5 UTSW 9 105875787 critical splice donor site probably null
R6315:Col6a5 UTSW 9 105881970 missense probably damaging 1.00
R6317:Col6a5 UTSW 9 105889067 missense probably damaging 1.00
R6414:Col6a5 UTSW 9 105892266 splice site probably null
R6434:Col6a5 UTSW 9 105937345 missense unknown
R6456:Col6a5 UTSW 9 105945477 missense unknown
R6698:Col6a5 UTSW 9 105934175 missense unknown
R6876:Col6a5 UTSW 9 105937307 missense unknown
R6882:Col6a5 UTSW 9 105940270 nonsense probably null
R6928:Col6a5 UTSW 9 105939919 missense unknown
X0054:Col6a5 UTSW 9 105915158 missense unknown
X0058:Col6a5 UTSW 9 105881778 nonsense probably null
Z1088:Col6a5 UTSW 9 105926067 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGACCCACATGGCAACAG -3'
(R):5'- TAAACTCGACGAGGCAGCAC -3'

Sequencing Primer
(F):5'- TTTAAGGGTGTCTAGCCCCACAG -3'
(R):5'- AGGCAGCACGGGAACTC -3'
Posted On2016-02-04