Incidental Mutation 'R4792:Lgr6'
ID368641
Institutional Source Beutler Lab
Gene Symbol Lgr6
Ensembl Gene ENSMUSG00000042793
Gene Nameleucine-rich repeat-containing G protein-coupled receptor 6
SynonymsA530037C04Rik
MMRRC Submission 042419-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4792 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134983301-135105276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135021806 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 229 (S229C)
Ref Sequence ENSEMBL: ENSMUSP00000035444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044828] [ENSMUST00000137968]
Predicted Effect probably benign
Transcript: ENSMUST00000044828
AA Change: S229C

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035444
Gene: ENSMUSG00000042793
AA Change: S229C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 34 70 5.19e-3 SMART
LRR 64 88 1.03e1 SMART
LRR_TYP 89 112 6.52e-5 SMART
LRR_TYP 113 136 2.71e-2 SMART
LRR_TYP 137 160 4.79e-3 SMART
LRR_TYP 161 184 1.58e-3 SMART
LRR_TYP 185 208 2.36e-2 SMART
LRR_TYP 209 232 3.39e-3 SMART
LRR 233 255 8.97e0 SMART
LRR_TYP 256 279 1.36e-2 SMART
Blast:LRR 281 303 6e-7 BLAST
LRR 327 350 9.24e1 SMART
LRR 351 373 1.41e0 SMART
LRR 374 396 4.84e1 SMART
LRR_TYP 397 420 4.54e-4 SMART
LRR_TYP 421 444 7.15e-2 SMART
transmembrane domain 568 590 N/A INTRINSIC
transmembrane domain 599 621 N/A INTRINSIC
transmembrane domain 643 665 N/A INTRINSIC
transmembrane domain 686 708 N/A INTRINSIC
transmembrane domain 728 750 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 808 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137968
SMART Domains Protein: ENSMUSP00000122334
Gene: ENSMUSG00000042793

DomainStartEndE-ValueType
Blast:LRR 4 26 2e-7 BLAST
LRR 50 73 9.24e1 SMART
LRR 74 96 1.41e0 SMART
LRR 97 119 4.84e1 SMART
LRR_TYP 120 143 4.54e-4 SMART
LRR_TYP 144 167 7.15e-2 SMART
Pfam:7tm_1 301 550 3.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139369
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane protein superfamily. The encoded protein is a glycoprotein hormone receptor with a large N-terminal extracellular domain that contains leucine-rich repeats important for the formation of a horseshoe-shaped interaction motif for ligand binding. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter/null allele are viable and fertile with no apparent abnormal phenotype. Similarly, mice homozygous for a knock-in allele are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik A G 13: 24,746,507 probably benign Het
2310061N02Rik A G 16: 88,707,763 S49P possibly damaging Het
Abcb1a T C 5: 8,746,657 probably null Het
Adgb G A 10: 10,398,903 T770I probably damaging Het
Adgre4 A T 17: 55,791,491 T134S probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Alox5 C A 6: 116,461,003 V8L possibly damaging Het
Ambra1 A G 2: 91,772,846 T392A possibly damaging Het
Apob A G 12: 8,008,051 I2145V probably benign Het
Arhgap39 A G 15: 76,741,517 Y196H possibly damaging Het
Carmil1 A G 13: 24,067,190 L439S probably damaging Het
Carmil1 A T 13: 24,141,676 S224T possibly damaging Het
Cfh G A 1: 140,100,823 Q706* probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Chrna5 A T 9: 55,004,701 I158F probably damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cul7 T A 17: 46,657,050 Y423* probably null Het
Cyp2e1 T C 7: 140,773,675 Y342H probably benign Het
D630045J12Rik T C 6: 38,148,340 K1580E probably damaging Het
Dnah6 A G 6: 73,089,668 M2573T probably damaging Het
Edem1 T A 6: 108,828,746 probably benign Het
Erp29 C T 5: 121,447,174 E86K probably benign Het
Esrp2 C A 8: 106,132,509 R535L probably damaging Het
Gabrb2 C T 11: 42,529,503 probably benign Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Herc1 T A 9: 66,495,984 V4395E possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmgb2 G A 8: 57,513,310 C106Y probably damaging Het
Hoxa10 T C 6: 52,232,501 probably benign Het
Hsd3b1 T A 3: 98,852,910 Y255F probably benign Het
Ick A G 9: 78,153,693 D207G probably damaging Het
Ighd T C 12: 113,416,199 K42E probably benign Het
Ighv1-26 T C 12: 114,788,571 Y51C possibly damaging Het
Ighv5-2 C T 12: 113,578,799 E19K possibly damaging Het
Ipo11 T C 13: 106,834,160 probably benign Het
Itk C T 11: 46,344,831 probably benign Het
Kat6a T A 8: 22,940,576 H1982Q unknown Het
Kdm4d C T 9: 14,463,390 V391I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lhx9 T A 1: 138,838,351 Y233F possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mapk4 T C 18: 73,937,250 T191A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naglu C T 11: 101,071,106 T135M probably damaging Het
Nomo1 T A 7: 46,044,219 probably null Het
Nop56 T A 2: 130,277,864 V75E possibly damaging Het
Nr1i3 G A 1: 171,218,595 C283Y probably damaging Het
Olfr1269 T A 2: 90,118,830 Y256F possibly damaging Het
Olfr557 G A 7: 102,698,726 G163R probably damaging Het
Olfr768 T G 10: 129,093,620 Y118S probably damaging Het
Pcdhga2 A G 18: 37,669,399 S99G probably benign Het
Pcnx T A 12: 81,919,151 D697E probably damaging Het
Plxnb1 G A 9: 109,110,648 D1462N probably damaging Het
Pnn G T 12: 59,072,205 V525F possibly damaging Het
Prrc2a A T 17: 35,156,487 D1062E probably damaging Het
Prss35 T A 9: 86,755,669 V164E probably damaging Het
Psapl1 T C 5: 36,205,203 S380P probably benign Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Rsph10b A G 5: 143,937,317 T79A probably damaging Het
Sbf2 T C 7: 110,351,610 Q1164R probably damaging Het
Scn7a T C 2: 66,726,248 D331G probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sspo G A 6: 48,461,585 S1529N probably benign Het
St8sia3 T A 18: 64,265,563 V31E probably benign Het
Sult1b1 A T 5: 87,515,047 W265R probably damaging Het
Supt5 G T 7: 28,316,329 Q863K probably benign Het
Tbc1d31 A G 15: 57,940,728 R380G probably benign Het
Tdpoz1 T A 3: 93,670,538 D313V possibly damaging Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tpx2 A T 2: 152,885,096 T428S probably damaging Het
Trip11 A T 12: 101,885,446 H786Q probably benign Het
Trpc6 A T 9: 8,626,614 M322L probably benign Het
Try10 T C 6: 41,355,452 V14A probably benign Het
Unc13d A T 11: 116,070,282 F416L probably damaging Het
Vmn2r75 A T 7: 86,163,170 M547K possibly damaging Het
Wdr78 T C 4: 103,072,684 K370R possibly damaging Het
Zbp1 A G 2: 173,209,213 F288S probably damaging Het
Zc3h11a T A 1: 133,640,698 Q71L probably damaging Het
Zfp40 G A 17: 23,177,034 T193I possibly damaging Het
Zfp607a T C 7: 27,878,653 Y383H probably benign Het
Zfp622 T A 15: 25,987,042 Y82* probably null Het
Zfp964 T C 8: 69,664,015 F422L probably benign Het
Other mutations in Lgr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Lgr6 APN 1 135001691 splice site probably benign
IGL02483:Lgr6 APN 1 135001691 splice site probably benign
IGL03270:Lgr6 APN 1 134997704 missense probably damaging 1.00
R0002:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0294:Lgr6 UTSW 1 134987891 missense probably damaging 0.99
R0294:Lgr6 UTSW 1 135105061 missense unknown
R0361:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0390:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0731:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0734:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0741:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0742:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0765:Lgr6 UTSW 1 134993886 missense probably benign 0.04
R0903:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0904:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0905:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0906:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0907:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0908:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0967:Lgr6 UTSW 1 134994012 missense probably damaging 1.00
R1078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1131:Lgr6 UTSW 1 134987304 missense probably damaging 0.98
R1440:Lgr6 UTSW 1 134987472 missense probably damaging 1.00
R1533:Lgr6 UTSW 1 135104932 missense possibly damaging 0.66
R1728:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1728:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1728:Lgr6 UTSW 1 135003476 missense probably benign
R1729:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1729:Lgr6 UTSW 1 134988009 missense probably benign
R1729:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1729:Lgr6 UTSW 1 135003476 missense probably benign
R1730:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1730:Lgr6 UTSW 1 134988009 missense probably benign
R1730:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1730:Lgr6 UTSW 1 135003476 missense probably benign
R1739:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1739:Lgr6 UTSW 1 134988009 missense probably benign
R1739:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1739:Lgr6 UTSW 1 135003476 missense probably benign
R1762:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1762:Lgr6 UTSW 1 134988009 missense probably benign
R1762:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1762:Lgr6 UTSW 1 135003476 missense probably benign
R1782:Lgr6 UTSW 1 134987979 missense probably damaging 0.98
R1783:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1783:Lgr6 UTSW 1 134988009 missense probably benign
R1783:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1783:Lgr6 UTSW 1 135003476 missense probably benign
R1784:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1784:Lgr6 UTSW 1 134988009 missense probably benign
R1784:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1784:Lgr6 UTSW 1 135003476 missense probably benign
R1785:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1785:Lgr6 UTSW 1 134988009 missense probably benign
R1785:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1785:Lgr6 UTSW 1 135003476 missense probably benign
R2020:Lgr6 UTSW 1 135075275 missense probably damaging 1.00
R3104:Lgr6 UTSW 1 135000472 splice site probably null
R4629:Lgr6 UTSW 1 135104932 missense probably damaging 0.99
R5001:Lgr6 UTSW 1 134990632 missense probably benign 0.01
R5191:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5194:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5195:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5196:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5197:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5228:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5230:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5243:Lgr6 UTSW 1 135109272 unclassified probably benign
R5299:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5300:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5417:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5419:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5601:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5603:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5636:Lgr6 UTSW 1 134987078 missense probably benign 0.28
R5699:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5748:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5767:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5825:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5971:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6138:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6258:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6259:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6260:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6740:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6871:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6984:Lgr6 UTSW 1 134988002 missense possibly damaging 0.54
R6986:Lgr6 UTSW 1 134993956 missense possibly damaging 0.80
R7233:Lgr6 UTSW 1 135000476 critical splice donor site probably null
Z1088:Lgr6 UTSW 1 134988071 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCTTGCTGAGTGACATCTTAGAG -3'
(R):5'- CGTGGCTTCAGAAATGGGTC -3'

Sequencing Primer
(F):5'- GTGACATCTTAGAGAAGAGTCCC -3'
(R):5'- TGCTTGTCCCTGGAGAAAAG -3'
Posted On2016-02-04