Incidental Mutation 'R4792:Herc1'
ID368686
Institutional Source Beutler Lab
Gene Symbol Herc1
Ensembl Gene ENSMUSG00000038664
Gene NameHECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonymstbl, D130015N03Rik, 2810449H11Rik
MMRRC Submission 042419-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4792 (G1)
Quality Score186
Status Validated
Chromosome9
Chromosomal Location66350450-66508775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66495984 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 4395 (V4395E)
Ref Sequence ENSEMBL: ENSMUSP00000044801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042824]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042824
AA Change: V4395E

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044801
Gene: ENSMUSG00000038664
AA Change: V4395E

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:RCC1 476 526 5.4e-15 PFAM
Pfam:RCC1_2 513 542 1.3e-9 PFAM
Pfam:RCC1 529 576 5.5e-16 PFAM
Pfam:RCC1 579 629 1.5e-10 PFAM
Pfam:RCC1 632 680 3.6e-9 PFAM
Pfam:RCC1_2 667 696 2.2e-11 PFAM
Pfam:RCC1 683 733 1.2e-14 PFAM
low complexity region 787 807 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1080 1100 N/A INTRINSIC
low complexity region 1348 1378 N/A INTRINSIC
low complexity region 1659 1676 N/A INTRINSIC
low complexity region 1865 1874 N/A INTRINSIC
low complexity region 2002 2030 N/A INTRINSIC
SPRY 2067 2188 1.8e-30 SMART
coiled coil region 2251 2280 N/A INTRINSIC
low complexity region 2410 2423 N/A INTRINSIC
low complexity region 2613 2629 N/A INTRINSIC
low complexity region 2633 2648 N/A INTRINSIC
low complexity region 2650 2667 N/A INTRINSIC
low complexity region 2736 2749 N/A INTRINSIC
low complexity region 2882 2896 N/A INTRINSIC
low complexity region 2924 2935 N/A INTRINSIC
low complexity region 2971 2987 N/A INTRINSIC
low complexity region 3045 3051 N/A INTRINSIC
low complexity region 3168 3186 N/A INTRINSIC
low complexity region 3191 3213 N/A INTRINSIC
low complexity region 3364 3379 N/A INTRINSIC
WD40 3415 3454 1.68e-6 SMART
WD40 3570 3608 3.68e1 SMART
WD40 3613 3652 4.3e-1 SMART
WD40 3657 3702 3.17e-2 SMART
WD40 3734 3773 8.29e-6 SMART
low complexity region 3950 3964 N/A INTRINSIC
Pfam:RCC1_2 4079 4111 7.3e-9 PFAM
Pfam:RCC1 4098 4147 3.4e-16 PFAM
Pfam:RCC1_2 4134 4163 1.8e-7 PFAM
Pfam:RCC1 4150 4199 7.2e-16 PFAM
Pfam:RCC1 4204 4252 6.1e-12 PFAM
Pfam:RCC1 4255 4304 2.4e-7 PFAM
Pfam:RCC1_2 4291 4320 5.8e-12 PFAM
Pfam:RCC1 4307 4356 8.9e-16 PFAM
Blast:HECTc 4389 4423 2e-11 BLAST
HECTc 4497 4846 8.2e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135600
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gen encodes a member of the HERC protein family. This protein stimulates guanine nucleotide exchange on ARF1 and Rab proteins. This protein may be involved in membrane transport processes. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for this spontaneous mutation exhibit an abnormal cerebellar Purkinje cell layer and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik A G 13: 24,746,507 probably benign Het
2310061N02Rik A G 16: 88,707,763 S49P possibly damaging Het
Abcb1a T C 5: 8,746,657 probably null Het
Adgb G A 10: 10,398,903 T770I probably damaging Het
Adgre4 A T 17: 55,791,491 T134S probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Alox5 C A 6: 116,461,003 V8L possibly damaging Het
Ambra1 A G 2: 91,772,846 T392A possibly damaging Het
Apob A G 12: 8,008,051 I2145V probably benign Het
Arhgap39 A G 15: 76,741,517 Y196H possibly damaging Het
Carmil1 A G 13: 24,067,190 L439S probably damaging Het
Carmil1 A T 13: 24,141,676 S224T possibly damaging Het
Cfh G A 1: 140,100,823 Q706* probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Chrna5 A T 9: 55,004,701 I158F probably damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cul7 T A 17: 46,657,050 Y423* probably null Het
Cyp2e1 T C 7: 140,773,675 Y342H probably benign Het
D630045J12Rik T C 6: 38,148,340 K1580E probably damaging Het
Dnah6 A G 6: 73,089,668 M2573T probably damaging Het
Edem1 T A 6: 108,828,746 probably benign Het
Erp29 C T 5: 121,447,174 E86K probably benign Het
Esrp2 C A 8: 106,132,509 R535L probably damaging Het
Gabrb2 C T 11: 42,529,503 probably benign Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmgb2 G A 8: 57,513,310 C106Y probably damaging Het
Hoxa10 T C 6: 52,232,501 probably benign Het
Hsd3b1 T A 3: 98,852,910 Y255F probably benign Het
Ick A G 9: 78,153,693 D207G probably damaging Het
Ighd T C 12: 113,416,199 K42E probably benign Het
Ighv1-26 T C 12: 114,788,571 Y51C possibly damaging Het
Ighv5-2 C T 12: 113,578,799 E19K possibly damaging Het
Ipo11 T C 13: 106,834,160 probably benign Het
Itk C T 11: 46,344,831 probably benign Het
Kat6a T A 8: 22,940,576 H1982Q unknown Het
Kdm4d C T 9: 14,463,390 V391I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lgr6 T A 1: 135,021,806 S229C probably benign Het
Lhx9 T A 1: 138,838,351 Y233F possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mapk4 T C 18: 73,937,250 T191A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naglu C T 11: 101,071,106 T135M probably damaging Het
Nomo1 T A 7: 46,044,219 probably null Het
Nop56 T A 2: 130,277,864 V75E possibly damaging Het
Nr1i3 G A 1: 171,218,595 C283Y probably damaging Het
Olfr1269 T A 2: 90,118,830 Y256F possibly damaging Het
Olfr557 G A 7: 102,698,726 G163R probably damaging Het
Olfr768 T G 10: 129,093,620 Y118S probably damaging Het
Pcdhga2 A G 18: 37,669,399 S99G probably benign Het
Pcnx T A 12: 81,919,151 D697E probably damaging Het
Plxnb1 G A 9: 109,110,648 D1462N probably damaging Het
Pnn G T 12: 59,072,205 V525F possibly damaging Het
Prrc2a A T 17: 35,156,487 D1062E probably damaging Het
Prss35 T A 9: 86,755,669 V164E probably damaging Het
Psapl1 T C 5: 36,205,203 S380P probably benign Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Rsph10b A G 5: 143,937,317 T79A probably damaging Het
Sbf2 T C 7: 110,351,610 Q1164R probably damaging Het
Scn7a T C 2: 66,726,248 D331G probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sspo G A 6: 48,461,585 S1529N probably benign Het
St8sia3 T A 18: 64,265,563 V31E probably benign Het
Sult1b1 A T 5: 87,515,047 W265R probably damaging Het
Supt5 G T 7: 28,316,329 Q863K probably benign Het
Tbc1d31 A G 15: 57,940,728 R380G probably benign Het
Tdpoz1 T A 3: 93,670,538 D313V possibly damaging Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tpx2 A T 2: 152,885,096 T428S probably damaging Het
Trip11 A T 12: 101,885,446 H786Q probably benign Het
Trpc6 A T 9: 8,626,614 M322L probably benign Het
Try10 T C 6: 41,355,452 V14A probably benign Het
Unc13d A T 11: 116,070,282 F416L probably damaging Het
Vmn2r75 A T 7: 86,163,170 M547K possibly damaging Het
Wdr78 T C 4: 103,072,684 K370R possibly damaging Het
Zbp1 A G 2: 173,209,213 F288S probably damaging Het
Zc3h11a T A 1: 133,640,698 Q71L probably damaging Het
Zfp40 G A 17: 23,177,034 T193I possibly damaging Het
Zfp607a T C 7: 27,878,653 Y383H probably benign Het
Zfp622 T A 15: 25,987,042 Y82* probably null Het
Zfp964 T C 8: 69,664,015 F422L probably benign Het
Other mutations in Herc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Herc1 APN 9 66483966 missense probably benign 0.02
IGL00159:Herc1 APN 9 66437682 missense possibly damaging 0.94
IGL00486:Herc1 APN 9 66476120 missense probably benign
IGL00717:Herc1 APN 9 66485002 missense probably damaging 1.00
IGL00766:Herc1 APN 9 66450741 missense probably damaging 1.00
IGL00776:Herc1 APN 9 66421038 missense probably benign
IGL00987:Herc1 APN 9 66408052 missense probably benign 0.07
IGL01090:Herc1 APN 9 66469175 nonsense probably null
IGL01098:Herc1 APN 9 66461922 critical splice donor site probably null
IGL01106:Herc1 APN 9 66476438 splice site probably benign
IGL01120:Herc1 APN 9 66428880 missense probably benign
IGL01359:Herc1 APN 9 66439268 missense probably benign 0.01
IGL01360:Herc1 APN 9 66483699 missense probably benign
IGL01364:Herc1 APN 9 66399361 missense probably benign 0.00
IGL01470:Herc1 APN 9 66497636 missense possibly damaging 0.94
IGL01670:Herc1 APN 9 66487060 missense probably damaging 1.00
IGL01825:Herc1 APN 9 66399807 missense probably benign 0.00
IGL01903:Herc1 APN 9 66386872 nonsense probably null
IGL01988:Herc1 APN 9 66488075 splice site probably benign
IGL02074:Herc1 APN 9 66450983 missense probably benign
IGL02089:Herc1 APN 9 66480869 missense probably damaging 1.00
IGL02177:Herc1 APN 9 66434511 missense probably benign
IGL02300:Herc1 APN 9 66476363 missense probably benign 0.01
IGL02304:Herc1 APN 9 66476414 missense probably benign 0.06
IGL02369:Herc1 APN 9 66492011 nonsense probably null
IGL02445:Herc1 APN 9 66433482 missense possibly damaging 0.95
IGL02447:Herc1 APN 9 66497328 missense possibly damaging 0.59
IGL02549:Herc1 APN 9 66399901 missense probably damaging 0.98
IGL02571:Herc1 APN 9 66434605 splice site probably benign
IGL02709:Herc1 APN 9 66497680 missense probably damaging 0.97
IGL02717:Herc1 APN 9 66371921 nonsense probably null
IGL02726:Herc1 APN 9 66441988 missense probably benign 0.37
IGL02733:Herc1 APN 9 66450992 missense probably benign
IGL02963:Herc1 APN 9 66388823 missense probably damaging 0.99
IGL03101:Herc1 APN 9 66487997 missense probably benign
IGL03193:Herc1 APN 9 66402680 missense probably benign
IGL03203:Herc1 APN 9 66388900 critical splice donor site probably null
IGL03216:Herc1 APN 9 66478946 missense probably benign 0.06
IGL03282:Herc1 APN 9 66451459 missense probably benign 0.05
IGL03295:Herc1 APN 9 66396703 missense possibly damaging 0.56
IGL03134:Herc1 UTSW 9 66434063 critical splice acceptor site probably benign
PIT4243001:Herc1 UTSW 9 66372207 missense probably benign 0.00
PIT4486001:Herc1 UTSW 9 66372389 missense probably damaging 1.00
PIT4696001:Herc1 UTSW 9 66479009 missense probably damaging 1.00
R0044:Herc1 UTSW 9 66448175 missense probably benign 0.04
R0044:Herc1 UTSW 9 66448175 missense probably benign 0.04
R0052:Herc1 UTSW 9 66400156 missense probably damaging 0.99
R0114:Herc1 UTSW 9 66461846 missense probably damaging 0.99
R0129:Herc1 UTSW 9 66448075 missense probably damaging 1.00
R0131:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0131:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0132:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0158:Herc1 UTSW 9 66495921 nonsense probably null
R0333:Herc1 UTSW 9 66464699 splice site probably null
R0384:Herc1 UTSW 9 66481050 splice site probably benign
R0419:Herc1 UTSW 9 66446074 splice site probably benign
R0453:Herc1 UTSW 9 66399772 missense probably benign 0.20
R0458:Herc1 UTSW 9 66476381 missense probably benign 0.12
R0490:Herc1 UTSW 9 66484999 missense probably damaging 1.00
R0506:Herc1 UTSW 9 66448159 missense probably damaging 0.99
R0513:Herc1 UTSW 9 66445645 missense possibly damaging 0.96
R0628:Herc1 UTSW 9 66450881 missense probably benign 0.35
R0666:Herc1 UTSW 9 66484888 splice site probably benign
R0674:Herc1 UTSW 9 66501192 missense probably damaging 0.99
R0682:Herc1 UTSW 9 66481981 missense possibly damaging 0.95
R0690:Herc1 UTSW 9 66386838 nonsense probably null
R0701:Herc1 UTSW 9 66487950 missense probably damaging 1.00
R0766:Herc1 UTSW 9 66504840 missense probably damaging 1.00
R0850:Herc1 UTSW 9 66466670 missense probably damaging 1.00
R0907:Herc1 UTSW 9 66433428 missense possibly damaging 0.94
R0972:Herc1 UTSW 9 66372145 missense probably damaging 1.00
R0976:Herc1 UTSW 9 66439878 missense possibly damaging 0.74
R1027:Herc1 UTSW 9 66455968 missense probably benign
R1200:Herc1 UTSW 9 66486124 missense probably damaging 1.00
R1226:Herc1 UTSW 9 66416263 missense probably benign 0.00
R1364:Herc1 UTSW 9 66400093 missense probably damaging 1.00
R1395:Herc1 UTSW 9 66439181 missense probably benign 0.13
R1432:Herc1 UTSW 9 66465469 missense probably benign 0.13
R1440:Herc1 UTSW 9 66467803 missense probably damaging 1.00
R1476:Herc1 UTSW 9 66508266 missense probably damaging 1.00
R1590:Herc1 UTSW 9 66491953 splice site probably benign
R1634:Herc1 UTSW 9 66473538 missense possibly damaging 0.51
R1700:Herc1 UTSW 9 66450678 unclassified probably null
R1753:Herc1 UTSW 9 66469010 missense probably damaging 1.00
R1753:Herc1 UTSW 9 66502084 critical splice donor site probably null
R1796:Herc1 UTSW 9 66388856 nonsense probably null
R1830:Herc1 UTSW 9 66497599 missense possibly damaging 0.95
R1855:Herc1 UTSW 9 66391426 missense possibly damaging 0.95
R1866:Herc1 UTSW 9 66450791 missense probably damaging 1.00
R1894:Herc1 UTSW 9 66479461 missense probably damaging 1.00
R1918:Herc1 UTSW 9 66476126 splice site probably null
R1999:Herc1 UTSW 9 66486078 missense probably benign 0.07
R2034:Herc1 UTSW 9 66441972 missense probably benign 0.01
R2138:Herc1 UTSW 9 66470307 missense possibly damaging 0.94
R2186:Herc1 UTSW 9 66439901 missense probably benign 0.45
R2192:Herc1 UTSW 9 66465406 missense probably damaging 0.99
R2312:Herc1 UTSW 9 66508281 nonsense probably null
R2338:Herc1 UTSW 9 66428969 missense possibly damaging 0.69
R3035:Herc1 UTSW 9 66483935 missense possibly damaging 0.89
R3732:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3732:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3733:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3917:Herc1 UTSW 9 66434466 missense possibly damaging 0.94
R3953:Herc1 UTSW 9 66433793 nonsense probably null
R4073:Herc1 UTSW 9 66418492 missense probably benign 0.12
R4075:Herc1 UTSW 9 66418492 missense probably benign 0.12
R4241:Herc1 UTSW 9 66448348 frame shift probably null
R4260:Herc1 UTSW 9 66448348 frame shift probably null
R4261:Herc1 UTSW 9 66448348 frame shift probably null
R4300:Herc1 UTSW 9 66489406 missense probably damaging 1.00
R4398:Herc1 UTSW 9 66479453 missense probably benign 0.13
R4426:Herc1 UTSW 9 66496005 missense probably damaging 1.00
R4427:Herc1 UTSW 9 66496005 missense probably damaging 1.00
R4590:Herc1 UTSW 9 66437664 missense probably damaging 0.97
R4630:Herc1 UTSW 9 66433714 splice site probably null
R4656:Herc1 UTSW 9 66394711 missense probably damaging 0.97
R4658:Herc1 UTSW 9 66479491 missense possibly damaging 0.50
R4663:Herc1 UTSW 9 66433378 missense probably damaging 0.98
R4675:Herc1 UTSW 9 66391458 missense probably damaging 1.00
R4678:Herc1 UTSW 9 66416269 missense probably benign 0.00
R4754:Herc1 UTSW 9 66501206 missense probably benign 0.00
R4766:Herc1 UTSW 9 66441929 missense probably benign 0.00
R4828:Herc1 UTSW 9 66497343 splice site probably null
R4832:Herc1 UTSW 9 66495971 missense probably benign 0.11
R4879:Herc1 UTSW 9 66462837 nonsense probably null
R4948:Herc1 UTSW 9 66484902 missense probably benign
R5021:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5022:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5023:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5024:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5025:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5026:Herc1 UTSW 9 66486126 missense probably benign 0.03
R5027:Herc1 UTSW 9 66473529 missense probably benign 0.01
R5027:Herc1 UTSW 9 66504618 missense probably damaging 0.98
R5038:Herc1 UTSW 9 66476460 intron probably benign
R5041:Herc1 UTSW 9 66429045 missense possibly damaging 0.86
R5053:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5137:Herc1 UTSW 9 66448223 missense probably benign
R5197:Herc1 UTSW 9 66448504 missense probably damaging 0.99
R5207:Herc1 UTSW 9 66399869 nonsense probably null
R5247:Herc1 UTSW 9 66434551 missense probably benign 0.01
R5267:Herc1 UTSW 9 66461809 missense probably damaging 1.00
R5274:Herc1 UTSW 9 66399409 missense probably benign
R5375:Herc1 UTSW 9 66467887 missense probably damaging 0.99
R5401:Herc1 UTSW 9 66502056 missense probably damaging 1.00
R5560:Herc1 UTSW 9 66451119 missense probably benign 0.02
R5566:Herc1 UTSW 9 66465537 missense possibly damaging 0.95
R5577:Herc1 UTSW 9 66481981 missense probably damaging 0.99
R5596:Herc1 UTSW 9 66434063 critical splice acceptor site probably benign
R5665:Herc1 UTSW 9 66465435 missense probably damaging 1.00
R5744:Herc1 UTSW 9 66508193 missense probably damaging 1.00
R5802:Herc1 UTSW 9 66462878 missense probably damaging 1.00
R5822:Herc1 UTSW 9 66445612 missense probably benign 0.00
R5954:Herc1 UTSW 9 66451492 splice site probably benign
R5977:Herc1 UTSW 9 66433322 missense possibly damaging 0.77
R6022:Herc1 UTSW 9 66483685 missense probably damaging 1.00
R6043:Herc1 UTSW 9 66408154 missense probably benign
R6046:Herc1 UTSW 9 66445549 missense probably damaging 0.99
R6089:Herc1 UTSW 9 66445532 missense probably damaging 1.00
R6123:Herc1 UTSW 9 66497250 missense probably damaging 0.97
R6155:Herc1 UTSW 9 66433423 missense possibly damaging 0.95
R6190:Herc1 UTSW 9 66376381 missense possibly damaging 0.56
R6220:Herc1 UTSW 9 66433788 missense probably damaging 1.00
R6265:Herc1 UTSW 9 66372016 missense probably benign 0.05
R6348:Herc1 UTSW 9 66487976 missense possibly damaging 0.77
R6362:Herc1 UTSW 9 66471908 missense probably damaging 1.00
R6394:Herc1 UTSW 9 66395059 missense probably damaging 0.99
R6434:Herc1 UTSW 9 66486182 missense probably damaging 0.99
R6483:Herc1 UTSW 9 66448529 missense possibly damaging 0.64
R6607:Herc1 UTSW 9 66418567 missense probably benign 0.02
R6633:Herc1 UTSW 9 66439252 nonsense probably null
R6634:Herc1 UTSW 9 66437744 missense probably benign
R6693:Herc1 UTSW 9 66478976 missense probably damaging 0.99
R6695:Herc1 UTSW 9 66483866 splice site probably null
R6748:Herc1 UTSW 9 66501188 frame shift probably null
R6750:Herc1 UTSW 9 66501188 frame shift probably null
R6751:Herc1 UTSW 9 66501188 frame shift probably null
R6774:Herc1 UTSW 9 66501188 frame shift probably null
R6785:Herc1 UTSW 9 66501188 frame shift probably null
R6786:Herc1 UTSW 9 66501188 frame shift probably null
R6856:Herc1 UTSW 9 66397898 missense probably benign 0.05
R6966:Herc1 UTSW 9 66411065 missense probably benign 0.07
R7020:Herc1 UTSW 9 66486078 missense probably benign 0.07
R7109:Herc1 UTSW 9 66481889 missense probably benign 0.03
R7122:Herc1 UTSW 9 66399774 missense possibly damaging 0.69
R7209:Herc1 UTSW 9 66385032 missense possibly damaging 0.95
R7222:Herc1 UTSW 9 66467499 missense probably damaging 0.98
R7303:Herc1 UTSW 9 66450816 missense possibly damaging 0.93
R7305:Herc1 UTSW 9 66461868 missense
X0011:Herc1 UTSW 9 66400159 missense probably benign 0.28
X0067:Herc1 UTSW 9 66448524 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGGTAGAGGAATAGATATCTCTGTAG -3'
(R):5'- GAATTACAGCTGGTGACCTCTCC -3'

Sequencing Primer
(F):5'- CAAGTGCCTCTGTGCTT -3'
(R):5'- AGCTGGTGACCTCTCCCTAAC -3'
Posted On2016-02-04