Incidental Mutation 'R4792:Ick'
ID368687
Institutional Source Beutler Lab
Gene Symbol Ick
Ensembl Gene ENSMUSG00000009828
Gene Nameintestinal cell kinase
Synonyms2210420N10Rik
MMRRC Submission 042419-MU
Accession Numbers

Genbank: NM_001163780, NM_019987

Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R4792 (G1)
Quality Score224
Status Validated
Chromosome9
Chromosomal Location78109192-78172107 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78153693 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 207 (D207G)
Ref Sequence ENSEMBL: ENSMUSP00000112961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044551] [ENSMUST00000117330] [ENSMUST00000118869]
Predicted Effect probably damaging
Transcript: ENSMUST00000044551
AA Change: D207G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048234
Gene: ENSMUSG00000009828
AA Change: D207G

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117330
AA Change: D207G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113655
Gene: ENSMUSG00000009828
AA Change: D207G

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 539 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118869
AA Change: D207G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112961
Gene: ENSMUSG00000009828
AA Change: D207G

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142402
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic protein kinases are enzymes that belong to a very extensive family of proteins which share a conserved catalytic core common with both serine/threonine and tyrosine protein kinases. This gene encodes an intestinal serine/threonine kinase harboring a dual phosphorylation site found in mitogen-activating protein (MAP) kinases. The protein localizes to the intestinal crypt region and is thought to be important in intestinal epithelial cell proliferation and differentiation. Alternative splicing has been observed at this locus and two variants, encoding the same isoform, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal primary cilium morphology and Shh signaling during limb digit patterning, peripheral edema, cleft palate, hydrocephalus, polydactyly, delayed skeletal development, and embryonic lethality at late stages of gestation. [provided by MGI curators]
Allele List at MGI

All alleles(29) : Targeted, other(1) Gene trapped(28)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik A G 13: 24,746,507 probably benign Het
2310061N02Rik A G 16: 88,707,763 S49P possibly damaging Het
Abcb1a T C 5: 8,746,657 probably null Het
Adgb G A 10: 10,398,903 T770I probably damaging Het
Adgre4 A T 17: 55,791,491 T134S probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Alox5 C A 6: 116,461,003 V8L possibly damaging Het
Ambra1 A G 2: 91,772,846 T392A possibly damaging Het
Apob A G 12: 8,008,051 I2145V probably benign Het
Arhgap39 A G 15: 76,741,517 Y196H possibly damaging Het
Carmil1 A G 13: 24,067,190 L439S probably damaging Het
Carmil1 A T 13: 24,141,676 S224T possibly damaging Het
Cfh G A 1: 140,100,823 Q706* probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Chrna5 A T 9: 55,004,701 I158F probably damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cul7 T A 17: 46,657,050 Y423* probably null Het
Cyp2e1 T C 7: 140,773,675 Y342H probably benign Het
D630045J12Rik T C 6: 38,148,340 K1580E probably damaging Het
Dnah6 A G 6: 73,089,668 M2573T probably damaging Het
Edem1 T A 6: 108,828,746 probably benign Het
Erp29 C T 5: 121,447,174 E86K probably benign Het
Esrp2 C A 8: 106,132,509 R535L probably damaging Het
Gabrb2 C T 11: 42,529,503 probably benign Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Herc1 T A 9: 66,495,984 V4395E possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmgb2 G A 8: 57,513,310 C106Y probably damaging Het
Hoxa10 T C 6: 52,232,501 probably benign Het
Hsd3b1 T A 3: 98,852,910 Y255F probably benign Het
Ighd T C 12: 113,416,199 K42E probably benign Het
Ighv1-26 T C 12: 114,788,571 Y51C possibly damaging Het
Ighv5-2 C T 12: 113,578,799 E19K possibly damaging Het
Ipo11 T C 13: 106,834,160 probably benign Het
Itk C T 11: 46,344,831 probably benign Het
Kat6a T A 8: 22,940,576 H1982Q unknown Het
Kdm4d C T 9: 14,463,390 V391I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lgr6 T A 1: 135,021,806 S229C probably benign Het
Lhx9 T A 1: 138,838,351 Y233F possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mapk4 T C 18: 73,937,250 T191A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naglu C T 11: 101,071,106 T135M probably damaging Het
Nomo1 T A 7: 46,044,219 probably null Het
Nop56 T A 2: 130,277,864 V75E possibly damaging Het
Nr1i3 G A 1: 171,218,595 C283Y probably damaging Het
Olfr1269 T A 2: 90,118,830 Y256F possibly damaging Het
Olfr557 G A 7: 102,698,726 G163R probably damaging Het
Olfr768 T G 10: 129,093,620 Y118S probably damaging Het
Pcdhga2 A G 18: 37,669,399 S99G probably benign Het
Pcnx T A 12: 81,919,151 D697E probably damaging Het
Plxnb1 G A 9: 109,110,648 D1462N probably damaging Het
Pnn G T 12: 59,072,205 V525F possibly damaging Het
Prrc2a A T 17: 35,156,487 D1062E probably damaging Het
Prss35 T A 9: 86,755,669 V164E probably damaging Het
Psapl1 T C 5: 36,205,203 S380P probably benign Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Rsph10b A G 5: 143,937,317 T79A probably damaging Het
Sbf2 T C 7: 110,351,610 Q1164R probably damaging Het
Scn7a T C 2: 66,726,248 D331G probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sspo G A 6: 48,461,585 S1529N probably benign Het
St8sia3 T A 18: 64,265,563 V31E probably benign Het
Sult1b1 A T 5: 87,515,047 W265R probably damaging Het
Supt5 G T 7: 28,316,329 Q863K probably benign Het
Tbc1d31 A G 15: 57,940,728 R380G probably benign Het
Tdpoz1 T A 3: 93,670,538 D313V possibly damaging Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tpx2 A T 2: 152,885,096 T428S probably damaging Het
Trip11 A T 12: 101,885,446 H786Q probably benign Het
Trpc6 A T 9: 8,626,614 M322L probably benign Het
Try10 T C 6: 41,355,452 V14A probably benign Het
Unc13d A T 11: 116,070,282 F416L probably damaging Het
Vmn2r75 A T 7: 86,163,170 M547K possibly damaging Het
Wdr78 T C 4: 103,072,684 K370R possibly damaging Het
Zbp1 A G 2: 173,209,213 F288S probably damaging Het
Zc3h11a T A 1: 133,640,698 Q71L probably damaging Het
Zfp40 G A 17: 23,177,034 T193I possibly damaging Het
Zfp607a T C 7: 27,878,653 Y383H probably benign Het
Zfp622 T A 15: 25,987,042 Y82* probably null Het
Zfp964 T C 8: 69,664,015 F422L probably benign Het
Other mutations in Ick
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ick APN 9 78164539 missense probably benign 0.00
IGL01679:Ick APN 9 78140025 missense possibly damaging 0.94
IGL02525:Ick APN 9 78160393 missense probably benign 0.37
IGL02719:Ick APN 9 78140019 missense probably damaging 0.99
H8930:Ick UTSW 9 78150619 missense possibly damaging 0.92
R0471:Ick UTSW 9 78155517 critical splice donor site probably null
R1626:Ick UTSW 9 78150637 missense probably damaging 1.00
R1824:Ick UTSW 9 78157862 missense probably benign
R2186:Ick UTSW 9 78131487 missense probably benign 0.07
R2872:Ick UTSW 9 78140100 splice site probably null
R2872:Ick UTSW 9 78140100 splice site probably null
R4609:Ick UTSW 9 78167789 utr 3 prime probably benign
R4737:Ick UTSW 9 78150654 missense probably damaging 1.00
R5001:Ick UTSW 9 78131519 missense probably damaging 1.00
R5060:Ick UTSW 9 78153696 missense probably benign 0.01
R5093:Ick UTSW 9 78140021 missense probably benign 0.24
R5393:Ick UTSW 9 78160715 missense probably benign
R6199:Ick UTSW 9 78164639 missense probably benign 0.04
R6412:Ick UTSW 9 78139976 missense probably damaging 1.00
R7038:Ick UTSW 9 78109202 unclassified probably benign
X0067:Ick UTSW 9 78155403 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCACATTGCATTTAGGGAAACG -3'
(R):5'- CTTGCTAGAGAACCTGAGCAG -3'

Sequencing Primer
(F):5'- GGGAAACGACATACTTTTACTGAG -3'
(R):5'- CTTGCTAGAGAACCTGAGCAGAGAAG -3'
Posted On2016-02-04