Incidental Mutation 'R4792:Mrc2'
ID368699
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Namemannose receptor, C type 2
SynonymsEndo180, uPARAP, novel lectin
MMRRC Submission 042419-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4792 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location105292643-105351139 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 105348431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
Predicted Effect probably benign
Transcript: ENSMUST00000021038
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100335
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Meta Mutation Damage Score 0.6228 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik A G 13: 24,746,507 probably benign Het
2310061N02Rik A G 16: 88,707,763 S49P possibly damaging Het
Abcb1a T C 5: 8,746,657 probably null Het
Adgb G A 10: 10,398,903 T770I probably damaging Het
Adgre4 A T 17: 55,791,491 T134S probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Alox5 C A 6: 116,461,003 V8L possibly damaging Het
Ambra1 A G 2: 91,772,846 T392A possibly damaging Het
Apob A G 12: 8,008,051 I2145V probably benign Het
Arhgap39 A G 15: 76,741,517 Y196H possibly damaging Het
Carmil1 A G 13: 24,067,190 L439S probably damaging Het
Carmil1 A T 13: 24,141,676 S224T possibly damaging Het
Cfh G A 1: 140,100,823 Q706* probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Chrna5 A T 9: 55,004,701 I158F probably damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cul7 T A 17: 46,657,050 Y423* probably null Het
Cyp2e1 T C 7: 140,773,675 Y342H probably benign Het
D630045J12Rik T C 6: 38,148,340 K1580E probably damaging Het
Dnah6 A G 6: 73,089,668 M2573T probably damaging Het
Edem1 T A 6: 108,828,746 probably benign Het
Erp29 C T 5: 121,447,174 E86K probably benign Het
Esrp2 C A 8: 106,132,509 R535L probably damaging Het
Gabrb2 C T 11: 42,529,503 probably benign Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Herc1 T A 9: 66,495,984 V4395E possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmgb2 G A 8: 57,513,310 C106Y probably damaging Het
Hoxa10 T C 6: 52,232,501 probably benign Het
Hsd3b1 T A 3: 98,852,910 Y255F probably benign Het
Ick A G 9: 78,153,693 D207G probably damaging Het
Ighd T C 12: 113,416,199 K42E probably benign Het
Ighv1-26 T C 12: 114,788,571 Y51C possibly damaging Het
Ighv5-2 C T 12: 113,578,799 E19K possibly damaging Het
Ipo11 T C 13: 106,834,160 probably benign Het
Itk C T 11: 46,344,831 probably benign Het
Kat6a T A 8: 22,940,576 H1982Q unknown Het
Kdm4d C T 9: 14,463,390 V391I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lgr6 T A 1: 135,021,806 S229C probably benign Het
Lhx9 T A 1: 138,838,351 Y233F possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mapk4 T C 18: 73,937,250 T191A probably damaging Het
Naglu C T 11: 101,071,106 T135M probably damaging Het
Nomo1 T A 7: 46,044,219 probably null Het
Nop56 T A 2: 130,277,864 V75E possibly damaging Het
Nr1i3 G A 1: 171,218,595 C283Y probably damaging Het
Olfr1269 T A 2: 90,118,830 Y256F possibly damaging Het
Olfr557 G A 7: 102,698,726 G163R probably damaging Het
Olfr768 T G 10: 129,093,620 Y118S probably damaging Het
Pcdhga2 A G 18: 37,669,399 S99G probably benign Het
Pcnx T A 12: 81,919,151 D697E probably damaging Het
Plxnb1 G A 9: 109,110,648 D1462N probably damaging Het
Pnn G T 12: 59,072,205 V525F possibly damaging Het
Prrc2a A T 17: 35,156,487 D1062E probably damaging Het
Prss35 T A 9: 86,755,669 V164E probably damaging Het
Psapl1 T C 5: 36,205,203 S380P probably benign Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Rsph10b A G 5: 143,937,317 T79A probably damaging Het
Sbf2 T C 7: 110,351,610 Q1164R probably damaging Het
Scn7a T C 2: 66,726,248 D331G probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sspo G A 6: 48,461,585 S1529N probably benign Het
St8sia3 T A 18: 64,265,563 V31E probably benign Het
Sult1b1 A T 5: 87,515,047 W265R probably damaging Het
Supt5 G T 7: 28,316,329 Q863K probably benign Het
Tbc1d31 A G 15: 57,940,728 R380G probably benign Het
Tdpoz1 T A 3: 93,670,538 D313V possibly damaging Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tpx2 A T 2: 152,885,096 T428S probably damaging Het
Trip11 A T 12: 101,885,446 H786Q probably benign Het
Trpc6 A T 9: 8,626,614 M322L probably benign Het
Try10 T C 6: 41,355,452 V14A probably benign Het
Unc13d A T 11: 116,070,282 F416L probably damaging Het
Vmn2r75 A T 7: 86,163,170 M547K possibly damaging Het
Wdr78 T C 4: 103,072,684 K370R possibly damaging Het
Zbp1 A G 2: 173,209,213 F288S probably damaging Het
Zc3h11a T A 1: 133,640,698 Q71L probably damaging Het
Zfp40 G A 17: 23,177,034 T193I possibly damaging Het
Zfp607a T C 7: 27,878,653 Y383H probably benign Het
Zfp622 T A 15: 25,987,042 Y82* probably null Het
Zfp964 T C 8: 69,664,015 F422L probably benign Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105332236 missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTTGAGCTGCCAGAGAAG -3'
(R):5'- CTGTGGAAGGAACCCATTGG -3'

Sequencing Primer
(F):5'- GGTCTATCACCATAAGGAGAATCTGC -3'
(R):5'- CCATTGGGAAGGTGTGGGAATG -3'
Posted On2016-02-04