Incidental Mutation 'R4793:Hltf'
ID368745
Institutional Source Beutler Lab
Gene Symbol Hltf
Ensembl Gene ENSMUSG00000002428
Gene Namehelicase-like transcription factor
SynonymsP113, Snf2l3, Smarca3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4793 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location20057811-20118490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 20063950 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 121 (Y121D)
Ref Sequence ENSEMBL: ENSMUSP00000002502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002502
AA Change: Y121D

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428
AA Change: Y121D

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 608 1.26e-32 SMART
RING 754 794 4.41e-6 SMART
low complexity region 814 828 N/A INTRINSIC
HELICc 859 944 2.24e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128127
Predicted Effect probably benign
Transcript: ENSMUST00000143005
AA Change: Y121D

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428
AA Change: Y121D

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 610 2.36e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145853
AA Change: Y59D

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428
AA Change: Y59D

DomainStartEndE-ValueType
HIRAN 1 92 2.7e-25 SMART
DEXDc 174 548 2.36e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154233
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,191,718 E1143V probably benign Het
Abi2 T A 1: 60,409,804 M1K probably null Het
Acp2 T C 2: 91,206,789 F205L probably benign Het
Adam17 T C 12: 21,347,395 N219D probably benign Het
Aldh2 T C 5: 121,568,979 S168G probably damaging Het
Arhgap15 A T 2: 44,142,341 E312D probably damaging Het
BC017158 A T 7: 128,288,202 probably benign Het
Calm5 T C 13: 3,854,401 S32P probably benign Het
Capn12 G A 7: 28,892,669 D671N probably benign Het
Ccdc73 A G 2: 105,017,782 probably null Het
Cdc20 T A 4: 118,437,064 I20F probably benign Het
Cdh23 A T 10: 60,331,350 I1841N probably damaging Het
Cftr T C 6: 18,226,088 V345A probably damaging Het
Col15a1 T C 4: 47,262,997 S550P possibly damaging Het
Col4a4 A G 1: 82,539,099 Y133H unknown Het
Csmd1 A G 8: 16,088,263 S1592P probably damaging Het
Cts6 T A 13: 61,201,812 M56L probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Diexf T A 1: 193,113,808 Q50L probably null Het
Dock5 A G 14: 67,800,354 S947P probably benign Het
Dpysl2 G T 14: 66,815,049 A339D possibly damaging Het
Ebf2 A G 14: 67,410,082 D360G probably damaging Het
Ensa T C 3: 95,625,178 probably null Het
Fap C A 2: 62,544,369 V229F probably damaging Het
Fbn1 C A 2: 125,321,235 G2116* probably null Het
Frmd4b A T 6: 97,295,861 S857T probably damaging Het
Fsip2 T A 2: 82,987,700 Y4592* probably null Het
Fubp1 T A 3: 152,223,329 Y135N possibly damaging Het
Gdap2 T C 3: 100,170,918 L66P probably damaging Het
Gm10257 T C 13: 100,946,797 noncoding transcript Het
Gm1758 A T 16: 14,507,172 noncoding transcript Het
Gna13 T C 11: 109,363,629 probably benign Het
Heatr1 T C 13: 12,431,837 I1689T probably benign Het
Hephl1 A G 9: 15,097,990 I102T probably benign Het
Hist1h2bl T C 13: 21,715,918 S76G probably benign Het
Hspg2 T C 4: 137,529,473 V1509A possibly damaging Het
Ifitm5 G T 7: 140,950,164 R16S probably benign Het
Il1rap A C 16: 26,695,234 D239A probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcna6 T C 6: 126,738,556 I457V probably damaging Het
Kctd17 T A 15: 78,433,024 L47Q probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc63 A G 14: 75,126,161 S177P possibly damaging Het
Lrriq1 T C 10: 103,170,466 D1266G probably benign Het
Map3k2 G T 18: 32,228,150 M554I probably damaging Het
Mettl7a3 A G 15: 100,335,008 M27V probably benign Het
Mst1r T A 9: 107,919,925 V1331E probably damaging Het
Musk T C 4: 58,373,400 I775T probably damaging Het
Mybl2 A G 2: 163,074,763 K7E probably damaging Het
Nf1 T C 11: 79,447,572 S1137P probably damaging Het
Nlrp5 A G 7: 23,417,630 I260V probably damaging Het
Olfr1006 A C 2: 85,674,498 Y218D probably damaging Het
Olfr1413 G T 1: 92,573,485 A105S possibly damaging Het
Olfr155 A T 4: 43,854,323 N5Y probably benign Het
Pabpc1l C T 2: 164,027,622 A114V possibly damaging Het
Plac8l1 T A 18: 42,178,908 I149F possibly damaging Het
Pou6f1 T A 15: 100,578,412 N531I probably damaging Het
Prdm10 A G 9: 31,353,405 Y712C probably damaging Het
Ptbp3 T C 4: 59,514,297 T43A possibly damaging Het
Ptpn13 T C 5: 103,582,778 probably null Het
Rnf135 T C 11: 80,196,949 probably null Het
Serpinb3d A G 1: 107,078,221 L379P probably damaging Het
Sh2d6 T A 6: 72,517,598 T124S probably benign Het
Slc26a5 G A 5: 21,837,994 P153S probably damaging Het
Slc5a7 A G 17: 54,281,794 F275S possibly damaging Het
Snx14 A G 9: 88,394,442 S606P probably damaging Het
Sphkap A T 1: 83,278,084 I648K possibly damaging Het
Spon2 T C 5: 33,214,560 T301A probably damaging Het
Srpr C T 9: 35,213,151 T48I probably benign Het
Taar9 G A 10: 24,109,510 P9S probably benign Het
Tacc1 A T 8: 25,182,389 S274R possibly damaging Het
Tc2n A G 12: 101,651,117 S348P possibly damaging Het
Timd2 G T 11: 46,687,181 T41K probably damaging Het
Tmem132a T A 19: 10,865,493 E206V probably damaging Het
Tpi1 A T 6: 124,812,581 probably benign Het
Traf5 T G 1: 191,997,804 T429P probably benign Het
Trav4-3 A G 14: 53,599,158 S27G possibly damaging Het
Tubd1 T C 11: 86,567,069 M462T probably benign Het
Ube4a T C 9: 44,948,822 D314G probably damaging Het
Vmn2r58 G T 7: 41,865,071 T158K probably damaging Het
Vmn2r68 C A 7: 85,234,440 M152I probably benign Het
Vmn2r91 A G 17: 18,105,396 E92G probably damaging Het
Wdr20rt T C 12: 65,226,621 V113A probably damaging Het
Zfp729a T C 13: 67,620,427 H561R probably damaging Het
Zfp804a T A 2: 82,235,842 D52E probably damaging Het
Other mutations in Hltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Hltf APN 3 20105632 splice site probably benign
IGL01461:Hltf APN 3 20099939 nonsense probably null
IGL01630:Hltf APN 3 20082904 splice site probably benign
IGL01704:Hltf APN 3 20083746 splice site probably benign
IGL02059:Hltf APN 3 20106457 missense probably benign
IGL02105:Hltf APN 3 20092757 missense probably damaging 1.00
IGL02156:Hltf APN 3 20092807 missense possibly damaging 0.61
IGL02870:Hltf APN 3 20099873 missense probably damaging 0.98
IGL02899:Hltf APN 3 20099817 missense probably damaging 1.00
IGL02935:Hltf APN 3 20069051 missense probably damaging 1.00
IGL02950:Hltf APN 3 20076572 missense probably benign 0.07
IGL03082:Hltf APN 3 20064559 splice site probably benign
R0068:Hltf UTSW 3 20059090 missense probably damaging 1.00
R0787:Hltf UTSW 3 20106446 missense probably damaging 1.00
R0905:Hltf UTSW 3 20108869 critical splice donor site probably null
R0980:Hltf UTSW 3 20091501 missense probably benign 0.00
R1741:Hltf UTSW 3 20086188 missense probably damaging 1.00
R1748:Hltf UTSW 3 20076521 missense probably benign 0.13
R1799:Hltf UTSW 3 20105691 missense probably damaging 1.00
R1976:Hltf UTSW 3 20106446 missense probably damaging 1.00
R2171:Hltf UTSW 3 20059081 missense probably damaging 1.00
R2395:Hltf UTSW 3 20092742 missense probably benign 0.41
R2444:Hltf UTSW 3 20063907 missense possibly damaging 0.66
R3789:Hltf UTSW 3 20069047 missense probably damaging 1.00
R3943:Hltf UTSW 3 20092744 missense probably damaging 1.00
R4719:Hltf UTSW 3 20064701 critical splice donor site probably null
R5296:Hltf UTSW 3 20108112 missense probably damaging 0.99
R5449:Hltf UTSW 3 20069083 missense possibly damaging 0.92
R5492:Hltf UTSW 3 20098067 splice site probably null
R6012:Hltf UTSW 3 20058934 missense probably damaging 1.00
R6157:Hltf UTSW 3 20076496 missense probably benign 0.13
R6254:Hltf UTSW 3 20063829 missense possibly damaging 0.85
R6553:Hltf UTSW 3 20072394 missense probably damaging 0.96
R6616:Hltf UTSW 3 20109487 critical splice donor site probably null
R6696:Hltf UTSW 3 20065306 intron probably null
R6761:Hltf UTSW 3 20083832 critical splice donor site probably null
R6781:Hltf UTSW 3 20098166 missense probably benign 0.00
X0027:Hltf UTSW 3 20067389 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGCGAATGAATCTTACAGTAGATT -3'
(R):5'- CATTTGCTGGATAGAAAAGGCA -3'

Sequencing Primer
(F):5'- ACGTGAGACTCTGTTCCAAG -3'
(R):5'- TTTGCTGGATAGAAAAGGCAGAGAAG -3'
Posted On2016-02-04