Incidental Mutation 'R4793:Ptbp3'
ID368752
Institutional Source Beutler Lab
Gene Symbol Ptbp3
Ensembl Gene ENSMUSG00000028382
Gene Namepolypyrimidine tract binding protein 3
SynonymsRod1, 5830471K22Rik
Accession Numbers

Genbank: NM_144904; MGI: 1923334; Ensembl: ENSMUST00000030076

Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R4793 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59471868-59549364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59514297 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 43 (T43A)
Ref Sequence ENSEMBL: ENSMUSP00000134290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030076] [ENSMUST00000102883] [ENSMUST00000134879] [ENSMUST00000140925] [ENSMUST00000148331] [ENSMUST00000172768] [ENSMUST00000173699] [ENSMUST00000173884] [ENSMUST00000174586] [ENSMUST00000174748]
Predicted Effect probably benign
Transcript: ENSMUST00000030076
AA Change: T109A

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030076
Gene: ENSMUSG00000028382
AA Change: T109A

DomainStartEndE-ValueType
RRM 31 100 2.24e-3 SMART
low complexity region 115 130 N/A INTRINSIC
RRM 154 223 2.51e-6 SMART
low complexity region 277 293 N/A INTRINSIC
RRM 330 399 2.13e-9 SMART
RRM 447 517 1.29e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102883
AA Change: T137A

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099947
Gene: ENSMUSG00000028382
AA Change: T137A

DomainStartEndE-ValueType
RRM 59 128 2.24e-3 SMART
low complexity region 143 158 N/A INTRINSIC
RRM 182 251 2.51e-6 SMART
low complexity region 305 321 N/A INTRINSIC
RRM 358 427 2.13e-9 SMART
RRM 475 545 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134879
Predicted Effect probably benign
Transcript: ENSMUST00000140925
SMART Domains Protein: ENSMUSP00000122138
Gene: ENSMUSG00000028382

DomainStartEndE-ValueType
SCOP:d1qm9a2 53 99 2e-4 SMART
PDB:2CQ1|A 54 101 8e-19 PDB
Blast:RRM 64 100 4e-19 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000148331
AA Change: T106A

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122840
Gene: ENSMUSG00000028382
AA Change: T106A

DomainStartEndE-ValueType
RRM 28 97 2.24e-3 SMART
low complexity region 112 127 N/A INTRINSIC
RRM 151 220 2.51e-6 SMART
low complexity region 274 290 N/A INTRINSIC
RRM 327 396 2.13e-9 SMART
RRM 444 514 1.29e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151313
Predicted Effect possibly damaging
Transcript: ENSMUST00000172768
AA Change: T106A

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134102
Gene: ENSMUSG00000028382
AA Change: T106A

DomainStartEndE-ValueType
RRM 28 97 2.24e-3 SMART
low complexity region 112 127 N/A INTRINSIC
RRM 151 220 2.51e-6 SMART
low complexity region 274 290 N/A INTRINSIC
RRM 327 396 2.13e-9 SMART
RRM 444 514 1.29e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173699
AA Change: T43A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134290
Gene: ENSMUSG00000028382
AA Change: T43A

DomainStartEndE-ValueType
PDB:2CQ1|A 2 44 7e-18 PDB
low complexity region 49 64 N/A INTRINSIC
RRM 88 157 2.51e-6 SMART
low complexity region 211 227 N/A INTRINSIC
RRM 264 333 2.13e-9 SMART
RRM 381 451 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173884
SMART Domains Protein: ENSMUSP00000133996
Gene: ENSMUSG00000028382

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
RRM 52 121 2.51e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174586
AA Change: T140A

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133612
Gene: ENSMUSG00000028382
AA Change: T140A

DomainStartEndE-ValueType
RRM 62 131 2.24e-3 SMART
low complexity region 146 161 N/A INTRINSIC
RRM 185 254 2.51e-6 SMART
low complexity region 308 324 N/A INTRINSIC
RRM 361 430 2.13e-9 SMART
RRM 478 548 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174748
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds RNA and is a regulator of cell differentiation. The encoded protein preferentially binds to poly(G) and poly(U) sequences in vitro. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,191,718 E1143V probably benign Het
Abi2 T A 1: 60,409,804 M1K probably null Het
Acp2 T C 2: 91,206,789 F205L probably benign Het
Adam17 T C 12: 21,347,395 N219D probably benign Het
Aldh2 T C 5: 121,568,979 S168G probably damaging Het
Arhgap15 A T 2: 44,142,341 E312D probably damaging Het
BC017158 A T 7: 128,288,202 probably benign Het
Calm5 T C 13: 3,854,401 S32P probably benign Het
Capn12 G A 7: 28,892,669 D671N probably benign Het
Ccdc73 A G 2: 105,017,782 probably null Het
Cdc20 T A 4: 118,437,064 I20F probably benign Het
Cdh23 A T 10: 60,331,350 I1841N probably damaging Het
Cftr T C 6: 18,226,088 V345A probably damaging Het
Col15a1 T C 4: 47,262,997 S550P possibly damaging Het
Col4a4 A G 1: 82,539,099 Y133H unknown Het
Csmd1 A G 8: 16,088,263 S1592P probably damaging Het
Cts6 T A 13: 61,201,812 M56L probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Diexf T A 1: 193,113,808 Q50L probably null Het
Dock5 A G 14: 67,800,354 S947P probably benign Het
Dpysl2 G T 14: 66,815,049 A339D possibly damaging Het
Ebf2 A G 14: 67,410,082 D360G probably damaging Het
Ensa T C 3: 95,625,178 probably null Het
Fap C A 2: 62,544,369 V229F probably damaging Het
Fbn1 C A 2: 125,321,235 G2116* probably null Het
Frmd4b A T 6: 97,295,861 S857T probably damaging Het
Fsip2 T A 2: 82,987,700 Y4592* probably null Het
Fubp1 T A 3: 152,223,329 Y135N possibly damaging Het
Gdap2 T C 3: 100,170,918 L66P probably damaging Het
Gm10257 T C 13: 100,946,797 noncoding transcript Het
Gm1758 A T 16: 14,507,172 noncoding transcript Het
Gna13 T C 11: 109,363,629 probably benign Het
Heatr1 T C 13: 12,431,837 I1689T probably benign Het
Hephl1 A G 9: 15,097,990 I102T probably benign Het
Hist1h2bl T C 13: 21,715,918 S76G probably benign Het
Hltf T G 3: 20,063,950 Y121D possibly damaging Het
Hspg2 T C 4: 137,529,473 V1509A possibly damaging Het
Ifitm5 G T 7: 140,950,164 R16S probably benign Het
Il1rap A C 16: 26,695,234 D239A probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcna6 T C 6: 126,738,556 I457V probably damaging Het
Kctd17 T A 15: 78,433,024 L47Q probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc63 A G 14: 75,126,161 S177P possibly damaging Het
Lrriq1 T C 10: 103,170,466 D1266G probably benign Het
Map3k2 G T 18: 32,228,150 M554I probably damaging Het
Mettl7a3 A G 15: 100,335,008 M27V probably benign Het
Mst1r T A 9: 107,919,925 V1331E probably damaging Het
Musk T C 4: 58,373,400 I775T probably damaging Het
Mybl2 A G 2: 163,074,763 K7E probably damaging Het
Nf1 T C 11: 79,447,572 S1137P probably damaging Het
Nlrp5 A G 7: 23,417,630 I260V probably damaging Het
Olfr1006 A C 2: 85,674,498 Y218D probably damaging Het
Olfr1413 G T 1: 92,573,485 A105S possibly damaging Het
Olfr155 A T 4: 43,854,323 N5Y probably benign Het
Pabpc1l C T 2: 164,027,622 A114V possibly damaging Het
Plac8l1 T A 18: 42,178,908 I149F possibly damaging Het
Pou6f1 T A 15: 100,578,412 N531I probably damaging Het
Prdm10 A G 9: 31,353,405 Y712C probably damaging Het
Ptpn13 T C 5: 103,582,778 probably null Het
Rnf135 T C 11: 80,196,949 probably null Het
Serpinb3d A G 1: 107,078,221 L379P probably damaging Het
Sh2d6 T A 6: 72,517,598 T124S probably benign Het
Slc26a5 G A 5: 21,837,994 P153S probably damaging Het
Slc5a7 A G 17: 54,281,794 F275S possibly damaging Het
Snx14 A G 9: 88,394,442 S606P probably damaging Het
Sphkap A T 1: 83,278,084 I648K possibly damaging Het
Spon2 T C 5: 33,214,560 T301A probably damaging Het
Srpr C T 9: 35,213,151 T48I probably benign Het
Taar9 G A 10: 24,109,510 P9S probably benign Het
Tacc1 A T 8: 25,182,389 S274R possibly damaging Het
Tc2n A G 12: 101,651,117 S348P possibly damaging Het
Timd2 G T 11: 46,687,181 T41K probably damaging Het
Tmem132a T A 19: 10,865,493 E206V probably damaging Het
Tpi1 A T 6: 124,812,581 probably benign Het
Traf5 T G 1: 191,997,804 T429P probably benign Het
Trav4-3 A G 14: 53,599,158 S27G possibly damaging Het
Tubd1 T C 11: 86,567,069 M462T probably benign Het
Ube4a T C 9: 44,948,822 D314G probably damaging Het
Vmn2r58 G T 7: 41,865,071 T158K probably damaging Het
Vmn2r68 C A 7: 85,234,440 M152I probably benign Het
Vmn2r91 A G 17: 18,105,396 E92G probably damaging Het
Wdr20rt T C 12: 65,226,621 V113A probably damaging Het
Zfp729a T C 13: 67,620,427 H561R probably damaging Het
Zfp804a T A 2: 82,235,842 D52E probably damaging Het
Other mutations in Ptbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Ptbp3 APN 4 59477228 missense probably benign 0.29
IGL03035:Ptbp3 APN 4 59477218 missense probably benign 0.00
IGL03118:Ptbp3 APN 4 59501470 missense probably benign 0.03
IGL03257:Ptbp3 APN 4 59493370 splice site probably benign
IGL03279:Ptbp3 APN 4 59476937 missense possibly damaging 0.68
R0557:Ptbp3 UTSW 4 59517684 nonsense probably null
R1741:Ptbp3 UTSW 4 59482624 missense probably damaging 0.98
R1914:Ptbp3 UTSW 4 59517635 missense probably damaging 1.00
R1915:Ptbp3 UTSW 4 59517635 missense probably damaging 1.00
R2679:Ptbp3 UTSW 4 59494615 splice site probably benign
R3798:Ptbp3 UTSW 4 59546166 missense probably benign 0.05
R4869:Ptbp3 UTSW 4 59524443 missense possibly damaging 0.79
R5573:Ptbp3 UTSW 4 59485626 missense probably damaging 1.00
R5986:Ptbp3 UTSW 4 59493311 missense probably benign 0.37
R6350:Ptbp3 UTSW 4 59482624 missense probably damaging 0.98
R6659:Ptbp3 UTSW 4 59517640 missense probably damaging 1.00
YA93:Ptbp3 UTSW 4 59524413 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GCCCAGTGTCATTTCTAACAC -3'
(R):5'- CCCTAGGGAACAATGTCAAGTATAC -3'

Sequencing Primer
(F):5'- GTGTCATTTCTAACACTACAACTTCC -3'
(R):5'- TACTGAGAAAACACAAGTTTAGACC -3'
Posted On2016-02-04