Incidental Mutation 'R4793:Kcna6'
ID368764
Institutional Source Beutler Lab
Gene Symbol Kcna6
Ensembl Gene ENSMUSG00000038077
Gene Namepotassium voltage-gated channel, shaker-related, subfamily, member 6
SynonymsMK1.6, Kv1.6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R4793 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126708329-126740674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126738556 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 457 (I457V)
Ref Sequence ENSEMBL: ENSMUSP00000139481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040751] [ENSMUST00000112242] [ENSMUST00000185333]
Predicted Effect probably damaging
Transcript: ENSMUST00000040751
AA Change: I457V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036872
Gene: ENSMUSG00000038077
AA Change: I457V

DomainStartEndE-ValueType
BTB 41 141 3.64e-9 SMART
transmembrane domain 175 197 N/A INTRINSIC
low complexity region 223 230 N/A INTRINSIC
low complexity region 240 257 N/A INTRINSIC
Pfam:Ion_trans 265 457 3.6e-36 PFAM
Pfam:Ion_trans_2 377 462 8.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112242
AA Change: I457V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107861
Gene: ENSMUSG00000038077
AA Change: I457V

DomainStartEndE-ValueType
BTB 41 141 3.64e-9 SMART
Pfam:Ion_trans 173 469 6.1e-52 PFAM
Pfam:Ion_trans_2 377 462 3.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181126
Predicted Effect probably damaging
Transcript: ENSMUST00000185333
AA Change: I457V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139481
Gene: ENSMUSG00000038077
AA Change: I457V

DomainStartEndE-ValueType
BTB 41 141 3.64e-9 SMART
transmembrane domain 175 197 N/A INTRINSIC
low complexity region 223 230 N/A INTRINSIC
low complexity region 240 257 N/A INTRINSIC
Pfam:Ion_trans 265 457 3.6e-36 PFAM
Pfam:Ion_trans_2 377 462 8.1e-14 PFAM
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class. The coding region of this gene is intronless, and the gene is clustered with genes KCNA1 and KCNA5 on chromosome 12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in an increased thermal nociceptive threshold and in females an increase in circulating triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,191,718 E1143V probably benign Het
Abi2 T A 1: 60,409,804 M1K probably null Het
Acp2 T C 2: 91,206,789 F205L probably benign Het
Adam17 T C 12: 21,347,395 N219D probably benign Het
Aldh2 T C 5: 121,568,979 S168G probably damaging Het
Arhgap15 A T 2: 44,142,341 E312D probably damaging Het
BC017158 A T 7: 128,288,202 probably benign Het
Calm5 T C 13: 3,854,401 S32P probably benign Het
Capn12 G A 7: 28,892,669 D671N probably benign Het
Ccdc73 A G 2: 105,017,782 probably null Het
Cdc20 T A 4: 118,437,064 I20F probably benign Het
Cdh23 A T 10: 60,331,350 I1841N probably damaging Het
Cftr T C 6: 18,226,088 V345A probably damaging Het
Col15a1 T C 4: 47,262,997 S550P possibly damaging Het
Col4a4 A G 1: 82,539,099 Y133H unknown Het
Csmd1 A G 8: 16,088,263 S1592P probably damaging Het
Cts6 T A 13: 61,201,812 M56L probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Diexf T A 1: 193,113,808 Q50L probably null Het
Dock5 A G 14: 67,800,354 S947P probably benign Het
Dpysl2 G T 14: 66,815,049 A339D possibly damaging Het
Ebf2 A G 14: 67,410,082 D360G probably damaging Het
Ensa T C 3: 95,625,178 probably null Het
Fap C A 2: 62,544,369 V229F probably damaging Het
Fbn1 C A 2: 125,321,235 G2116* probably null Het
Frmd4b A T 6: 97,295,861 S857T probably damaging Het
Fsip2 T A 2: 82,987,700 Y4592* probably null Het
Fubp1 T A 3: 152,223,329 Y135N possibly damaging Het
Gdap2 T C 3: 100,170,918 L66P probably damaging Het
Gm10257 T C 13: 100,946,797 noncoding transcript Het
Gm1758 A T 16: 14,507,172 noncoding transcript Het
Gna13 T C 11: 109,363,629 probably benign Het
Heatr1 T C 13: 12,431,837 I1689T probably benign Het
Hephl1 A G 9: 15,097,990 I102T probably benign Het
Hist1h2bl T C 13: 21,715,918 S76G probably benign Het
Hltf T G 3: 20,063,950 Y121D possibly damaging Het
Hspg2 T C 4: 137,529,473 V1509A possibly damaging Het
Ifitm5 G T 7: 140,950,164 R16S probably benign Het
Il1rap A C 16: 26,695,234 D239A probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kctd17 T A 15: 78,433,024 L47Q probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc63 A G 14: 75,126,161 S177P possibly damaging Het
Lrriq1 T C 10: 103,170,466 D1266G probably benign Het
Map3k2 G T 18: 32,228,150 M554I probably damaging Het
Mettl7a3 A G 15: 100,335,008 M27V probably benign Het
Mst1r T A 9: 107,919,925 V1331E probably damaging Het
Musk T C 4: 58,373,400 I775T probably damaging Het
Mybl2 A G 2: 163,074,763 K7E probably damaging Het
Nf1 T C 11: 79,447,572 S1137P probably damaging Het
Nlrp5 A G 7: 23,417,630 I260V probably damaging Het
Olfr1006 A C 2: 85,674,498 Y218D probably damaging Het
Olfr1413 G T 1: 92,573,485 A105S possibly damaging Het
Olfr155 A T 4: 43,854,323 N5Y probably benign Het
Pabpc1l C T 2: 164,027,622 A114V possibly damaging Het
Plac8l1 T A 18: 42,178,908 I149F possibly damaging Het
Pou6f1 T A 15: 100,578,412 N531I probably damaging Het
Prdm10 A G 9: 31,353,405 Y712C probably damaging Het
Ptbp3 T C 4: 59,514,297 T43A possibly damaging Het
Ptpn13 T C 5: 103,582,778 probably null Het
Rnf135 T C 11: 80,196,949 probably null Het
Serpinb3d A G 1: 107,078,221 L379P probably damaging Het
Sh2d6 T A 6: 72,517,598 T124S probably benign Het
Slc26a5 G A 5: 21,837,994 P153S probably damaging Het
Slc5a7 A G 17: 54,281,794 F275S possibly damaging Het
Snx14 A G 9: 88,394,442 S606P probably damaging Het
Sphkap A T 1: 83,278,084 I648K possibly damaging Het
Spon2 T C 5: 33,214,560 T301A probably damaging Het
Srpr C T 9: 35,213,151 T48I probably benign Het
Taar9 G A 10: 24,109,510 P9S probably benign Het
Tacc1 A T 8: 25,182,389 S274R possibly damaging Het
Tc2n A G 12: 101,651,117 S348P possibly damaging Het
Timd2 G T 11: 46,687,181 T41K probably damaging Het
Tmem132a T A 19: 10,865,493 E206V probably damaging Het
Tpi1 A T 6: 124,812,581 probably benign Het
Traf5 T G 1: 191,997,804 T429P probably benign Het
Trav4-3 A G 14: 53,599,158 S27G possibly damaging Het
Tubd1 T C 11: 86,567,069 M462T probably benign Het
Ube4a T C 9: 44,948,822 D314G probably damaging Het
Vmn2r58 G T 7: 41,865,071 T158K probably damaging Het
Vmn2r68 C A 7: 85,234,440 M152I probably benign Het
Vmn2r91 A G 17: 18,105,396 E92G probably damaging Het
Wdr20rt T C 12: 65,226,621 V113A probably damaging Het
Zfp729a T C 13: 67,620,427 H561R probably damaging Het
Zfp804a T A 2: 82,235,842 D52E probably damaging Het
Other mutations in Kcna6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Kcna6 APN 6 126738613 missense probably damaging 1.00
IGL01623:Kcna6 APN 6 126738613 missense probably damaging 1.00
IGL02385:Kcna6 APN 6 126738954 missense probably benign
IGL02452:Kcna6 APN 6 126738480 missense possibly damaging 0.57
IGL02480:Kcna6 APN 6 126738568 missense probably damaging 1.00
IGL02604:Kcna6 APN 6 126739204 missense probably benign 0.17
IGL02794:Kcna6 APN 6 126738552 missense probably damaging 1.00
R1599:Kcna6 UTSW 6 126739319 missense probably benign 0.00
R1932:Kcna6 UTSW 6 126738488 missense probably benign 0.16
R1984:Kcna6 UTSW 6 126738510 missense probably benign 0.34
R1985:Kcna6 UTSW 6 126738510 missense probably benign 0.34
R2114:Kcna6 UTSW 6 126739359 missense possibly damaging 0.93
R4111:Kcna6 UTSW 6 126739774 missense probably damaging 1.00
R4112:Kcna6 UTSW 6 126739774 missense probably damaging 1.00
R4818:Kcna6 UTSW 6 126738424 missense probably benign 0.00
R4884:Kcna6 UTSW 6 126738726 missense probably benign 0.08
R5126:Kcna6 UTSW 6 126738732 missense probably damaging 1.00
R5754:Kcna6 UTSW 6 126739725 missense probably damaging 1.00
R6074:Kcna6 UTSW 6 126739279 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAAACCTCGGTGAGCATCC -3'
(R):5'- AGAGGCTGATGATGTTGACTCG -3'

Sequencing Primer
(F):5'- TCCGCATAAGCTCGATGTG -3'
(R):5'- GCTGATGATGTTGACTCGCTCTTC -3'
Posted On2016-02-04