Incidental Mutation 'R4793:Kctd17'
ID368805
Institutional Source Beutler Lab
Gene Symbol Kctd17
Ensembl Gene ENSMUSG00000033287
Gene Namepotassium channel tetramerisation domain containing 17
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4793 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78428564-78439303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78433024 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 47 (L47Q)
Ref Sequence ENSEMBL: ENSMUSP00000155227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089414] [ENSMUST00000159771] [ENSMUST00000162321] [ENSMUST00000162517] [ENSMUST00000166142] [ENSMUST00000229290] [ENSMUST00000229622]
Predicted Effect probably damaging
Transcript: ENSMUST00000089414
AA Change: L120Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086835
Gene: ENSMUSG00000033287
AA Change: L120Q

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
coiled coil region 208 244 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159771
AA Change: L113Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125574
Gene: ENSMUSG00000033287
AA Change: L113Q

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
BTB 24 125 1.76e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161016
Predicted Effect probably damaging
Transcript: ENSMUST00000162321
AA Change: L74Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125680
Gene: ENSMUSG00000033287
AA Change: L74Q

DomainStartEndE-ValueType
BTB 3 86 9.93e-2 SMART
low complexity region 168 195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162517
AA Change: L120Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124290
Gene: ENSMUSG00000033287
AA Change: L120Q

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
low complexity region 227 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162605
Predicted Effect unknown
Transcript: ENSMUST00000162808
AA Change: L35Q
SMART Domains Protein: ENSMUSP00000125421
Gene: ENSMUSG00000033287
AA Change: L35Q

DomainStartEndE-ValueType
SCOP:d3kvt__ 2 36 3e-8 SMART
Blast:BTB 2 98 6e-30 BLAST
PDB:3DRY|E 2 127 4e-69 PDB
low complexity region 130 157 N/A INTRINSIC
low complexity region 160 187 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166142
AA Change: L120Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133210
Gene: ENSMUSG00000033287
AA Change: L120Q

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229290
AA Change: L18Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000229622
AA Change: L47Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.664 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a conserved family of potassium channel tetramerization domain (KCTD)-containing proteins. The encoded protein functions in ciliogenesis by acting as a substrate adaptor for the cullin3-based ubiquitin-conjugating enzyme E3 ligase, and targets trichoplein, a keratin-binding protein, for degradation via polyubiquitinylation. A mutation in this gene is associated with autosomal dominant myoclonic dystonia 26. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,191,718 E1143V probably benign Het
Abi2 T A 1: 60,409,804 M1K probably null Het
Acp2 T C 2: 91,206,789 F205L probably benign Het
Adam17 T C 12: 21,347,395 N219D probably benign Het
Aldh2 T C 5: 121,568,979 S168G probably damaging Het
Arhgap15 A T 2: 44,142,341 E312D probably damaging Het
BC017158 A T 7: 128,288,202 probably benign Het
Calm5 T C 13: 3,854,401 S32P probably benign Het
Capn12 G A 7: 28,892,669 D671N probably benign Het
Ccdc73 A G 2: 105,017,782 probably null Het
Cdc20 T A 4: 118,437,064 I20F probably benign Het
Cdh23 A T 10: 60,331,350 I1841N probably damaging Het
Cftr T C 6: 18,226,088 V345A probably damaging Het
Col15a1 T C 4: 47,262,997 S550P possibly damaging Het
Col4a4 A G 1: 82,539,099 Y133H unknown Het
Csmd1 A G 8: 16,088,263 S1592P probably damaging Het
Cts6 T A 13: 61,201,812 M56L probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Diexf T A 1: 193,113,808 Q50L probably null Het
Dock5 A G 14: 67,800,354 S947P probably benign Het
Dpysl2 G T 14: 66,815,049 A339D possibly damaging Het
Ebf2 A G 14: 67,410,082 D360G probably damaging Het
Ensa T C 3: 95,625,178 probably null Het
Fap C A 2: 62,544,369 V229F probably damaging Het
Fbn1 C A 2: 125,321,235 G2116* probably null Het
Frmd4b A T 6: 97,295,861 S857T probably damaging Het
Fsip2 T A 2: 82,987,700 Y4592* probably null Het
Fubp1 T A 3: 152,223,329 Y135N possibly damaging Het
Gdap2 T C 3: 100,170,918 L66P probably damaging Het
Gm10257 T C 13: 100,946,797 noncoding transcript Het
Gm1758 A T 16: 14,507,172 noncoding transcript Het
Gna13 T C 11: 109,363,629 probably benign Het
Heatr1 T C 13: 12,431,837 I1689T probably benign Het
Hephl1 A G 9: 15,097,990 I102T probably benign Het
Hist1h2bl T C 13: 21,715,918 S76G probably benign Het
Hltf T G 3: 20,063,950 Y121D possibly damaging Het
Hspg2 T C 4: 137,529,473 V1509A possibly damaging Het
Ifitm5 G T 7: 140,950,164 R16S probably benign Het
Il1rap A C 16: 26,695,234 D239A probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcna6 T C 6: 126,738,556 I457V probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc63 A G 14: 75,126,161 S177P possibly damaging Het
Lrriq1 T C 10: 103,170,466 D1266G probably benign Het
Map3k2 G T 18: 32,228,150 M554I probably damaging Het
Mettl7a3 A G 15: 100,335,008 M27V probably benign Het
Mst1r T A 9: 107,919,925 V1331E probably damaging Het
Musk T C 4: 58,373,400 I775T probably damaging Het
Mybl2 A G 2: 163,074,763 K7E probably damaging Het
Nf1 T C 11: 79,447,572 S1137P probably damaging Het
Nlrp5 A G 7: 23,417,630 I260V probably damaging Het
Olfr1006 A C 2: 85,674,498 Y218D probably damaging Het
Olfr1413 G T 1: 92,573,485 A105S possibly damaging Het
Olfr155 A T 4: 43,854,323 N5Y probably benign Het
Pabpc1l C T 2: 164,027,622 A114V possibly damaging Het
Plac8l1 T A 18: 42,178,908 I149F possibly damaging Het
Pou6f1 T A 15: 100,578,412 N531I probably damaging Het
Prdm10 A G 9: 31,353,405 Y712C probably damaging Het
Ptbp3 T C 4: 59,514,297 T43A possibly damaging Het
Ptpn13 T C 5: 103,582,778 probably null Het
Rnf135 T C 11: 80,196,949 probably null Het
Serpinb3d A G 1: 107,078,221 L379P probably damaging Het
Sh2d6 T A 6: 72,517,598 T124S probably benign Het
Slc26a5 G A 5: 21,837,994 P153S probably damaging Het
Slc5a7 A G 17: 54,281,794 F275S possibly damaging Het
Snx14 A G 9: 88,394,442 S606P probably damaging Het
Sphkap A T 1: 83,278,084 I648K possibly damaging Het
Spon2 T C 5: 33,214,560 T301A probably damaging Het
Srpr C T 9: 35,213,151 T48I probably benign Het
Taar9 G A 10: 24,109,510 P9S probably benign Het
Tacc1 A T 8: 25,182,389 S274R possibly damaging Het
Tc2n A G 12: 101,651,117 S348P possibly damaging Het
Timd2 G T 11: 46,687,181 T41K probably damaging Het
Tmem132a T A 19: 10,865,493 E206V probably damaging Het
Tpi1 A T 6: 124,812,581 probably benign Het
Traf5 T G 1: 191,997,804 T429P probably benign Het
Trav4-3 A G 14: 53,599,158 S27G possibly damaging Het
Tubd1 T C 11: 86,567,069 M462T probably benign Het
Ube4a T C 9: 44,948,822 D314G probably damaging Het
Vmn2r58 G T 7: 41,865,071 T158K probably damaging Het
Vmn2r68 C A 7: 85,234,440 M152I probably benign Het
Vmn2r91 A G 17: 18,105,396 E92G probably damaging Het
Wdr20rt T C 12: 65,226,621 V113A probably damaging Het
Zfp729a T C 13: 67,620,427 H561R probably damaging Het
Zfp804a T A 2: 82,235,842 D52E probably damaging Het
Other mutations in Kctd17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02079:Kctd17 APN 15 78430156 splice site probably benign
IGL02209:Kctd17 APN 15 78435592 missense probably damaging 1.00
IGL03132:Kctd17 APN 15 78435687 missense probably damaging 1.00
R4676:Kctd17 UTSW 15 78435759 unclassified probably benign
R5428:Kctd17 UTSW 15 78428782 missense probably damaging 1.00
R5590:Kctd17 UTSW 15 78437302 unclassified probably benign
R5779:Kctd17 UTSW 15 78437133 unclassified probably benign
R6249:Kctd17 UTSW 15 78430039 unclassified probably null
R6911:Kctd17 UTSW 15 78434006 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATGTCAACTCTTTCTTGACCCTTG -3'
(R):5'- GGCATGATAACCCTTGGTCAC -3'

Sequencing Primer
(F):5'- GAACTCATGGACCCTTACGTG -3'
(R):5'- TTGGTCACACACAGCAGAAG -3'
Posted On2016-02-04