Incidental Mutation 'R4793:Il1rap'
ID368809
Institutional Source Beutler Lab
Gene Symbol Il1rap
Ensembl Gene ENSMUSG00000022514
Gene Nameinterleukin 1 receptor accessory protein
SynonymsIL-1RAcP, 6430709H04Rik, IL-1R AcP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4793 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location26581704-26730117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 26695234 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 239 (D239A)
Ref Sequence ENSEMBL: ENSMUSP00000133904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023156] [ENSMUST00000096129] [ENSMUST00000166294] [ENSMUST00000174171] [ENSMUST00000174202]
Predicted Effect probably benign
Transcript: ENSMUST00000023156
AA Change: D239A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000023156
Gene: ENSMUSG00000022514
AA Change: D239A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 549 5.29e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096129
AA Change: D239A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000093843
Gene: ENSMUSG00000022514
AA Change: D239A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166294
AA Change: D239A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000128100
Gene: ENSMUSG00000022514
AA Change: D239A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174171
AA Change: D239A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133904
Gene: ENSMUSG00000022514
AA Change: D239A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
Blast:IG 251 312 1e-28 BLAST
low complexity region 316 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174202
AA Change: D239A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134202
Gene: ENSMUSG00000022514
AA Change: D239A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes the interleukin 1 receptor accessory protein. The protein is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal but show no biological response to IL-1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,191,718 E1143V probably benign Het
Abi2 T A 1: 60,409,804 M1K probably null Het
Acp2 T C 2: 91,206,789 F205L probably benign Het
Adam17 T C 12: 21,347,395 N219D probably benign Het
Aldh2 T C 5: 121,568,979 S168G probably damaging Het
Arhgap15 A T 2: 44,142,341 E312D probably damaging Het
BC017158 A T 7: 128,288,202 probably benign Het
Calm5 T C 13: 3,854,401 S32P probably benign Het
Capn12 G A 7: 28,892,669 D671N probably benign Het
Ccdc73 A G 2: 105,017,782 probably null Het
Cdc20 T A 4: 118,437,064 I20F probably benign Het
Cdh23 A T 10: 60,331,350 I1841N probably damaging Het
Cftr T C 6: 18,226,088 V345A probably damaging Het
Col15a1 T C 4: 47,262,997 S550P possibly damaging Het
Col4a4 A G 1: 82,539,099 Y133H unknown Het
Csmd1 A G 8: 16,088,263 S1592P probably damaging Het
Cts6 T A 13: 61,201,812 M56L probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Diexf T A 1: 193,113,808 Q50L probably null Het
Dock5 A G 14: 67,800,354 S947P probably benign Het
Dpysl2 G T 14: 66,815,049 A339D possibly damaging Het
Ebf2 A G 14: 67,410,082 D360G probably damaging Het
Ensa T C 3: 95,625,178 probably null Het
Fap C A 2: 62,544,369 V229F probably damaging Het
Fbn1 C A 2: 125,321,235 G2116* probably null Het
Frmd4b A T 6: 97,295,861 S857T probably damaging Het
Fsip2 T A 2: 82,987,700 Y4592* probably null Het
Fubp1 T A 3: 152,223,329 Y135N possibly damaging Het
Gdap2 T C 3: 100,170,918 L66P probably damaging Het
Gm10257 T C 13: 100,946,797 noncoding transcript Het
Gm1758 A T 16: 14,507,172 noncoding transcript Het
Gna13 T C 11: 109,363,629 probably benign Het
Heatr1 T C 13: 12,431,837 I1689T probably benign Het
Hephl1 A G 9: 15,097,990 I102T probably benign Het
Hist1h2bl T C 13: 21,715,918 S76G probably benign Het
Hltf T G 3: 20,063,950 Y121D possibly damaging Het
Hspg2 T C 4: 137,529,473 V1509A possibly damaging Het
Ifitm5 G T 7: 140,950,164 R16S probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcna6 T C 6: 126,738,556 I457V probably damaging Het
Kctd17 T A 15: 78,433,024 L47Q probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc63 A G 14: 75,126,161 S177P possibly damaging Het
Lrriq1 T C 10: 103,170,466 D1266G probably benign Het
Map3k2 G T 18: 32,228,150 M554I probably damaging Het
Mettl7a3 A G 15: 100,335,008 M27V probably benign Het
Mst1r T A 9: 107,919,925 V1331E probably damaging Het
Musk T C 4: 58,373,400 I775T probably damaging Het
Mybl2 A G 2: 163,074,763 K7E probably damaging Het
Nf1 T C 11: 79,447,572 S1137P probably damaging Het
Nlrp5 A G 7: 23,417,630 I260V probably damaging Het
Olfr1006 A C 2: 85,674,498 Y218D probably damaging Het
Olfr1413 G T 1: 92,573,485 A105S possibly damaging Het
Olfr155 A T 4: 43,854,323 N5Y probably benign Het
Pabpc1l C T 2: 164,027,622 A114V possibly damaging Het
Plac8l1 T A 18: 42,178,908 I149F possibly damaging Het
Pou6f1 T A 15: 100,578,412 N531I probably damaging Het
Prdm10 A G 9: 31,353,405 Y712C probably damaging Het
Ptbp3 T C 4: 59,514,297 T43A possibly damaging Het
Ptpn13 T C 5: 103,582,778 probably null Het
Rnf135 T C 11: 80,196,949 probably null Het
Serpinb3d A G 1: 107,078,221 L379P probably damaging Het
Sh2d6 T A 6: 72,517,598 T124S probably benign Het
Slc26a5 G A 5: 21,837,994 P153S probably damaging Het
Slc5a7 A G 17: 54,281,794 F275S possibly damaging Het
Snx14 A G 9: 88,394,442 S606P probably damaging Het
Sphkap A T 1: 83,278,084 I648K possibly damaging Het
Spon2 T C 5: 33,214,560 T301A probably damaging Het
Srpr C T 9: 35,213,151 T48I probably benign Het
Taar9 G A 10: 24,109,510 P9S probably benign Het
Tacc1 A T 8: 25,182,389 S274R possibly damaging Het
Tc2n A G 12: 101,651,117 S348P possibly damaging Het
Timd2 G T 11: 46,687,181 T41K probably damaging Het
Tmem132a T A 19: 10,865,493 E206V probably damaging Het
Tpi1 A T 6: 124,812,581 probably benign Het
Traf5 T G 1: 191,997,804 T429P probably benign Het
Trav4-3 A G 14: 53,599,158 S27G possibly damaging Het
Tubd1 T C 11: 86,567,069 M462T probably benign Het
Ube4a T C 9: 44,948,822 D314G probably damaging Het
Vmn2r58 G T 7: 41,865,071 T158K probably damaging Het
Vmn2r68 C A 7: 85,234,440 M152I probably benign Het
Vmn2r91 A G 17: 18,105,396 E92G probably damaging Het
Wdr20rt T C 12: 65,226,621 V113A probably damaging Het
Zfp729a T C 13: 67,620,427 H561R probably damaging Het
Zfp804a T A 2: 82,235,842 D52E probably damaging Het
Other mutations in Il1rap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Il1rap APN 16 26722401 missense possibly damaging 0.77
IGL00976:Il1rap APN 16 26698839 missense probably benign 0.09
IGL01075:Il1rap APN 16 26680237 missense possibly damaging 0.94
IGL01665:Il1rap APN 16 26722713 missense probably damaging 1.00
IGL01962:Il1rap APN 16 26710568 nonsense probably null
IGL02101:Il1rap APN 16 26624182 missense possibly damaging 0.61
IGL02411:Il1rap APN 16 26710616 missense probably damaging 1.00
IGL03132:Il1rap APN 16 26680119 missense probably damaging 1.00
bacchus UTSW 16 26710632 critical splice donor site probably null
I1329:Il1rap UTSW 16 26692850 missense probably benign 0.07
LCD18:Il1rap UTSW 16 26631593 intron probably benign
PIT1430001:Il1rap UTSW 16 26710593 missense possibly damaging 0.53
R0302:Il1rap UTSW 16 26692794 missense probably benign 0.02
R0454:Il1rap UTSW 16 26698875 missense probably damaging 1.00
R0481:Il1rap UTSW 16 26692835 missense probably damaging 1.00
R0612:Il1rap UTSW 16 26701105 missense possibly damaging 0.48
R0765:Il1rap UTSW 16 26710632 critical splice donor site probably null
R1552:Il1rap UTSW 16 26722434 missense possibly damaging 0.79
R1801:Il1rap UTSW 16 26698875 missense probably damaging 1.00
R1867:Il1rap UTSW 16 26722926 missense probably damaging 1.00
R1942:Il1rap UTSW 16 26722455 missense probably damaging 1.00
R1996:Il1rap UTSW 16 26722493 missense probably benign 0.06
R2118:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R2122:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R2124:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R3104:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3105:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3106:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3891:Il1rap UTSW 16 26676856 missense probably damaging 1.00
R4133:Il1rap UTSW 16 26722886 missense probably benign 0.34
R4409:Il1rap UTSW 16 26712265 splice site probably null
R4610:Il1rap UTSW 16 26714776 missense probably benign 0.11
R4755:Il1rap UTSW 16 26722782 missense probably benign 0.20
R4776:Il1rap UTSW 16 26692799 missense possibly damaging 0.57
R4811:Il1rap UTSW 16 26701238 critical splice donor site probably null
R4834:Il1rap UTSW 16 26676935 missense probably damaging 1.00
R5119:Il1rap UTSW 16 26624199 missense probably benign 0.01
R5744:Il1rap UTSW 16 26680224 missense probably benign 0.01
R6108:Il1rap UTSW 16 26722707 missense probably damaging 1.00
R6149:Il1rap UTSW 16 26712219 missense probably damaging 1.00
R6233:Il1rap UTSW 16 26710506 missense probably benign 0.24
R6246:Il1rap UTSW 16 26714881 missense probably benign
R6249:Il1rap UTSW 16 26692848 missense possibly damaging 0.88
R6254:Il1rap UTSW 16 26695270 missense probably benign
R6748:Il1rap UTSW 16 26722356 missense probably benign 0.02
R7151:Il1rap UTSW 16 26712128 missense probably damaging 1.00
X0027:Il1rap UTSW 16 26701147 missense probably benign 0.20
X0028:Il1rap UTSW 16 26676964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCACAAGTTCCATGTTAGC -3'
(R):5'- TGGTCCTTACGTGCTGTAGC -3'

Sequencing Primer
(F):5'- GCACAAGTTCCATGTTAGCACTAAG -3'
(R):5'- ACGTGCTGTAGCTTTTGATCATGC -3'
Posted On2016-02-04