Incidental Mutation 'R4794:Prkg2'
ID368842
Institutional Source Beutler Lab
Gene Symbol Prkg2
Ensembl Gene ENSMUSG00000029334
Gene Nameprotein kinase, cGMP-dependent, type II
SynonymsPrkgr2, cGK-II
MMRRC Submission 042420-MU
Accession Numbers

NCBI RefSeq: NM_008926.4; MGI: 108173

Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R4794 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location98929773-99037351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98966633 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 523 (T523I)
Ref Sequence ENSEMBL: ENSMUSP00000031277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031277] [ENSMUST00000161490]
Predicted Effect probably damaging
Transcript: ENSMUST00000031277
AA Change: T523I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031277
Gene: ENSMUSG00000029334
AA Change: T523I

DomainStartEndE-ValueType
coiled coil region 19 85 N/A INTRINSIC
cNMP 168 284 2.82e-19 SMART
cNMP 286 409 3.02e-28 SMART
S_TKc 424 682 9.46e-75 SMART
S_TK_X 683 733 9.83e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160765
Predicted Effect possibly damaging
Transcript: ENSMUST00000161490
AA Change: T552I

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124963
Gene: ENSMUSG00000029334
AA Change: T552I

DomainStartEndE-ValueType
coiled coil region 19 85 N/A INTRINSIC
cNMP 168 284 2.82e-19 SMART
cNMP 286 409 3.02e-28 SMART
S_TKc 453 711 1.19e-89 SMART
S_TK_X 712 762 9.83e-4 SMART
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype Strain: 24494704
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase family of proteins. The encoded protein plays a role in the regulation of fluid balance in the intestine. A similar protein in mouse is thought to regulate differentiation and proliferation of cells in the colon. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice exhibit dwarfism, with abnormal skull morphology and short limbs and vertebrae. Defects in axial organization of the growth plates was evident as mice aged. Digestive secretion in response to enterotoxin was reduced. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Prkg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Prkg2 APN 5 99024541 missense probably benign 0.00
IGL01063:Prkg2 APN 5 98969936 critical splice donor site probably null
IGL02060:Prkg2 APN 5 99024515 missense probably benign 0.32
IGL02666:Prkg2 APN 5 98997519 splice site probably benign
IGL02992:Prkg2 APN 5 99024506 missense probably benign
IGL03040:Prkg2 APN 5 98973107 critical splice donor site probably null
devito UTSW 5 98966510 critical splice donor site probably null
P0005:Prkg2 UTSW 5 98969947 missense probably damaging 1.00
R0044:Prkg2 UTSW 5 98973130 missense probably damaging 0.98
R0044:Prkg2 UTSW 5 98973130 missense probably damaging 0.98
R0115:Prkg2 UTSW 5 98994655 splice site probably null
R0403:Prkg2 UTSW 5 98994645 missense possibly damaging 0.95
R0452:Prkg2 UTSW 5 98997520 splice site probably benign
R0481:Prkg2 UTSW 5 98994655 splice site probably null
R1194:Prkg2 UTSW 5 98971926 missense probably benign 0.00
R1534:Prkg2 UTSW 5 98994561 missense probably damaging 1.00
R1861:Prkg2 UTSW 5 98947416 missense probably damaging 1.00
R2010:Prkg2 UTSW 5 99024805 missense probably benign
R2031:Prkg2 UTSW 5 99024451 missense possibly damaging 0.85
R2176:Prkg2 UTSW 5 98966509 splice site probably benign
R3607:Prkg2 UTSW 5 98947377 missense probably damaging 1.00
R3958:Prkg2 UTSW 5 98997495 missense possibly damaging 0.84
R3960:Prkg2 UTSW 5 98997495 missense possibly damaging 0.84
R4012:Prkg2 UTSW 5 98979815 missense possibly damaging 0.93
R4840:Prkg2 UTSW 5 98981143 missense probably benign 0.03
R4867:Prkg2 UTSW 5 99024709 missense probably benign 0.21
R5182:Prkg2 UTSW 5 99024709 missense probably benign 0.21
R5226:Prkg2 UTSW 5 98976462 missense possibly damaging 0.92
R5274:Prkg2 UTSW 5 98969991 missense probably damaging 1.00
R5416:Prkg2 UTSW 5 98943467 missense probably benign 0.05
R5531:Prkg2 UTSW 5 98967734 missense probably damaging 1.00
R5619:Prkg2 UTSW 5 98988297 missense probably damaging 1.00
R6264:Prkg2 UTSW 5 98934364 missense probably benign 0.22
R6925:Prkg2 UTSW 5 98966510 critical splice donor site probably null
Z1088:Prkg2 UTSW 5 99024804 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGTATTCGAGGGCCACTCC -3'
(R):5'- GCATATCAGTGTTCTCATGGC -3'

Sequencing Primer
(F):5'- GAGACTGCAACTATAGCACAACTTTG -3'
(R):5'- CTGAGGCCCACTGAGCTAG -3'
Posted On2016-02-04