Incidental Mutation 'R4794:D630045J12Rik'
ID368846
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene NameRIKEN cDNA D630045J12 gene
Synonyms
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4794 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location38123174-38254009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38194485 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 916 (T916I)
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117556
AA Change: T775I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455
AA Change: T775I

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149557
Predicted Effect possibly damaging
Transcript: ENSMUST00000169256
AA Change: T916I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455
AA Change: T916I

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Meta Mutation Damage Score 0.0548 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38194930 missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38136963 missense probably benign
IGL01745:D630045J12Rik APN 6 38191720 missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38184072 missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38196394 missense probably benign
IGL02496:D630045J12Rik APN 6 38149705 missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38195485 missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38149713 missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38168221 missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38147259 missense probably damaging 1.00
PIT4472001:D630045J12Rik UTSW 6 38178839 missense probably damaging 1.00
PIT4687001:D630045J12Rik UTSW 6 38195101 missense probably benign
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0128:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0130:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0206:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0208:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38181392 missense probably damaging 0.97
R0396:D630045J12Rik UTSW 6 38196736 missense possibly damaging 0.85
R0538:D630045J12Rik UTSW 6 38191693 missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38196778 missense probably benign
R0842:D630045J12Rik UTSW 6 38148465 missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38194770 missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38195760 missense probably benign 0.03
R1546:D630045J12Rik UTSW 6 38190655 missense probably damaging 1.00
R1649:D630045J12Rik UTSW 6 38181431 missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38139427 missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R2182:D630045J12Rik UTSW 6 38174147 critical splice donor site probably null
R2354:D630045J12Rik UTSW 6 38158091 missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38168171 missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38142909 missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38142698 missense possibly damaging 0.90
R4439:D630045J12Rik UTSW 6 38194761 missense probably benign 0.07
R4688:D630045J12Rik UTSW 6 38196657 missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38196036 missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38196841 missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38148340 missense probably damaging 1.00
R4947:D630045J12Rik UTSW 6 38148543 missense probably damaging 1.00
R4959:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R5261:D630045J12Rik UTSW 6 38194620 missense probably benign
R5344:D630045J12Rik UTSW 6 38158228 missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38191764 missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38196367 missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38142657 missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38194969 missense possibly damaging 0.70
R6021:D630045J12Rik UTSW 6 38190617 missense probably benign 0.05
R6060:D630045J12Rik UTSW 6 38130864 missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38142698 missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38147197 nonsense probably null
R6930:D630045J12Rik UTSW 6 38158216 missense probably damaging 1.00
R7019:D630045J12Rik UTSW 6 38194635 missense probably benign 0.12
R7156:D630045J12Rik UTSW 6 38195029 missense possibly damaging 0.91
R7248:D630045J12Rik UTSW 6 38168263 missense probably damaging 1.00
R7249:D630045J12Rik UTSW 6 38136950 missense possibly damaging 0.95
R7250:D630045J12Rik UTSW 6 38142611 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTATGTGAGGCCAACACCTACTC -3'
(R):5'- TTGACATCCACAGATTTCCCGC -3'

Sequencing Primer
(F):5'- ACAATGGTGTCCTGTAATTCTGCAC -3'
(R):5'- CAGATTTCCCGCCCAGTAC -3'
Posted On2016-02-04