Incidental Mutation 'R4794:Sf1'
ID368887
Institutional Source Beutler Lab
Gene Symbol Sf1
Ensembl Gene ENSMUSG00000024949
Gene Namesplicing factor 1
SynonymsMZFM, Zfp162, CW17R, WBP4
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4794 (G1)
Quality Score191
Status Not validated
Chromosome19
Chromosomal Location6363690-6378030 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 6375664 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113485] [ENSMUST00000113487] [ENSMUST00000113488] [ENSMUST00000113489] [ENSMUST00000124667] [ENSMUST00000131252] [ENSMUST00000144409] [ENSMUST00000155973]
Predicted Effect probably benign
Transcript: ENSMUST00000113485
SMART Domains Protein: ENSMUSP00000109113
Gene: ENSMUSG00000024949

DomainStartEndE-ValueType
PDB:2M0G|A 1 86 3e-33 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000113487
SMART Domains Protein: ENSMUSP00000109115
Gene: ENSMUSG00000024949

DomainStartEndE-ValueType
KH 134 227 4.38e-13 SMART
ZnF_C2HC 278 294 4.45e-3 SMART
low complexity region 335 358 N/A INTRINSIC
low complexity region 378 402 N/A INTRINSIC
low complexity region 406 446 N/A INTRINSIC
low complexity region 468 524 N/A INTRINSIC
low complexity region 532 540 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113488
AA Change: T530K
SMART Domains Protein: ENSMUSP00000109116
Gene: ENSMUSG00000024949
AA Change: T530K

DomainStartEndE-ValueType
KH 134 227 4.38e-13 SMART
ZnF_C2HC 278 294 4.45e-3 SMART
low complexity region 335 358 N/A INTRINSIC
low complexity region 378 402 N/A INTRINSIC
low complexity region 406 446 N/A INTRINSIC
low complexity region 468 524 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
low complexity region 567 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113489
SMART Domains Protein: ENSMUSP00000109117
Gene: ENSMUSG00000024949

DomainStartEndE-ValueType
KH 134 227 4.38e-13 SMART
ZnF_C2HC 278 294 4.45e-3 SMART
low complexity region 335 358 N/A INTRINSIC
low complexity region 378 402 N/A INTRINSIC
low complexity region 406 448 N/A INTRINSIC
low complexity region 472 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124667
SMART Domains Protein: ENSMUSP00000114788
Gene: ENSMUSG00000024949

DomainStartEndE-ValueType
low complexity region 22 46 N/A INTRINSIC
low complexity region 50 90 N/A INTRINSIC
low complexity region 120 176 N/A INTRINSIC
low complexity region 184 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125516
SMART Domains Protein: ENSMUSP00000117172
Gene: ENSMUSG00000024949

DomainStartEndE-ValueType
low complexity region 24 47 N/A INTRINSIC
low complexity region 67 91 N/A INTRINSIC
low complexity region 95 135 N/A INTRINSIC
low complexity region 157 171 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000131252
AA Change: T530K
SMART Domains Protein: ENSMUSP00000121309
Gene: ENSMUSG00000024949
AA Change: T530K

DomainStartEndE-ValueType
Pfam:SF1-HH 18 130 1.5e-47 PFAM
KH 134 227 4.38e-13 SMART
ZnF_C2HC 278 294 4.45e-3 SMART
low complexity region 335 358 N/A INTRINSIC
low complexity region 378 402 N/A INTRINSIC
low complexity region 406 446 N/A INTRINSIC
low complexity region 468 524 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
low complexity region 564 609 N/A INTRINSIC
low complexity region 615 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144239
Predicted Effect probably benign
Transcript: ENSMUST00000144409
SMART Domains Protein: ENSMUSP00000123175
Gene: ENSMUSG00000024949

DomainStartEndE-ValueType
PDB:2M09|A 1 27 4e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154260
Predicted Effect probably benign
Transcript: ENSMUST00000155973
SMART Domains Protein: ENSMUSP00000114438
Gene: ENSMUSG00000024949

DomainStartEndE-ValueType
PDB:4FXW|D 1 106 9e-71 PDB
KH 108 201 4.38e-13 SMART
ZnF_C2HC 252 267 1.43e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162237
AA Change: D132E
SMART Domains Protein: ENSMUSP00000124590
Gene: ENSMUSG00000024949
AA Change: D132E

DomainStartEndE-ValueType
low complexity region 11 55 N/A INTRINSIC
low complexity region 74 119 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype PHENOTYPE: Mice heterozygous for a gene trapped allele exhibit embryonic lethalilty prior to E8.5. Mice heterozygous for a gene trapped allele exhibit increased incidence of chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Sf1 APN 19 6372022 unclassified probably benign
IGL01713:Sf1 APN 19 6374289 critical splice donor site probably null
R0004:Sf1 UTSW 19 6374191 missense probably damaging 0.98
R1638:Sf1 UTSW 19 6372060 missense possibly damaging 0.62
R2999:Sf1 UTSW 19 6374876 unclassified probably benign
R4088:Sf1 UTSW 19 6368440 critical splice donor site probably null
R4254:Sf1 UTSW 19 6371647 missense probably damaging 1.00
R4559:Sf1 UTSW 19 6374815 small deletion probably benign
R4575:Sf1 UTSW 19 6375913 unclassified probably benign
R4736:Sf1 UTSW 19 6365664 missense probably damaging 0.99
R5050:Sf1 UTSW 19 6372559 missense probably damaging 1.00
R6678:Sf1 UTSW 19 6374513 splice site probably null
R6834:Sf1 UTSW 19 6374097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGTTAAGCCCAGAGACCATGAG -3'
(R):5'- ATACATCATGCCGGCGGAAC -3'

Sequencing Primer
(F):5'- CAGAGACCATGAGGCTGACC -3'
(R):5'- CGGAACCAGGTGGCGGAG -3'
Posted On2016-02-04