Incidental Mutation 'R4795:Bglap'
ID368908
Institutional Source Beutler Lab
Gene Symbol Bglap
Ensembl Gene ENSMUSG00000074483
Gene Namebone gamma carboxyglutamate protein
SynonymsBglap, Bglap1, bone Gla protein, mOC-A, OC, OG1, osteocalcin
MMRRC Submission 041996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R4795 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88383501-88384464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88384405 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 4 (I4S)
Ref Sequence ENSEMBL: ENSMUSP00000075425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076048]
Predicted Effect unknown
Transcript: ENSMUST00000076048
AA Change: I4S
SMART Domains Protein: ENSMUSP00000075425
Gene: ENSMUSG00000074483
AA Change: I4S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.22e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107540
SMART Domains Protein: ENSMUSP00000103164
Gene: ENSMUSG00000078691

DomainStartEndE-ValueType
Pfam:HlyIII 5 127 3.4e-21 PFAM
transmembrane domain 148 170 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128732
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (123/125)
MGI Phenotype FUNCTION: This gene encodes one of the most abundant non-collagenous proteins in bone tissue that is localized to the mineralized matrix of bone. The encoded preproprotein undergoes proteolytic processing and post-translational gamma carboxylation to generate a mature, calcium-binding protein. Mice lacking the encoded protein develop abnormalities of bone remodelling. This gene is located adjacent to two other osteocalcin-related genes on chromosome 3. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele of both Bglap1 and Bglap2 exhibit decreased circulating insulin, impaired glucose tolerance, increased adipose tissue, increased bone density, and decreased male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,176,123 L2259R probably damaging Het
Acd A G 8: 105,701,015 S2P possibly damaging Het
Acsf3 A G 8: 122,780,157 Y63C possibly damaging Het
Adam21 T C 12: 81,560,974 I5V probably benign Het
Adamts6 C A 13: 104,444,128 S783* probably null Het
Adamtsl1 T C 4: 86,243,769 probably null Het
Adck2 T A 6: 39,576,393 S313T probably benign Het
Adgb A G 10: 10,357,872 I1285T probably benign Het
Angptl1 T A 1: 156,860,583 M485K possibly damaging Het
Ank3 G A 10: 69,858,265 V289I probably benign Het
Atp13a4 A G 16: 29,490,008 probably null Het
Atp1a1 A G 3: 101,583,775 L648P probably benign Het
Atp2a3 A G 11: 72,973,029 I194V probably benign Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Ccdc112 T A 18: 46,287,672 Q337L probably benign Het
Cd34 T G 1: 194,951,011 S194A probably damaging Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Commd9 A G 2: 101,898,896 N116D probably benign Het
Dab2 C A 15: 6,429,611 P335T probably benign Het
Epb41l3 T A 17: 69,248,719 probably null Het
Epha2 A G 4: 141,322,416 probably null Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glyr1 A C 16: 5,047,758 V44G probably benign Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm18856 C A 13: 13,965,208 probably benign Het
Gm44501 A G 17: 40,578,714 K40E probably benign Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Hdhd5 T C 6: 120,523,446 H97R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hsf5 A G 11: 87,635,620 M373V probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Iigp1 T A 18: 60,389,892 F27L probably benign Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Kbtbd3 G A 9: 4,331,073 W482* probably null Het
Kcnq1 A G 7: 143,182,757 T168A probably benign Het
Lrch3 A G 16: 33,005,704 N631S probably damaging Het
Lrrk1 T A 7: 66,262,665 I1716F possibly damaging Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Map4 T C 9: 110,035,263 S519P probably benign Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc5b A G 7: 141,849,567 E755G unknown Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Necab1 G T 4: 15,111,208 D73E possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nfyb A T 10: 82,752,368 probably benign Het
Nol4 T C 18: 22,921,887 Q162R probably damaging Het
Nwd2 G A 5: 63,805,433 D787N probably benign Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr205 C T 16: 59,328,850 V220I probably benign Het
Olfr49 A G 14: 54,282,547 M116T probably damaging Het
Olfr535 A G 7: 140,493,007 D123G probably damaging Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr740 A C 14: 50,453,417 M122L probably damaging Het
Olfr908 T A 9: 38,516,503 M157K probably damaging Het
Orai3 T C 7: 127,773,888 V187A probably benign Het
Parn T C 16: 13,606,202 T444A probably benign Het
Pcdh11x A C X: 120,400,240 N460T probably damaging Het
Pcnt C T 10: 76,370,024 R2516H probably benign Het
Pde4d T A 13: 109,938,171 probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Pgm1 A G 5: 64,103,874 Y237C probably damaging Het
Plcb2 A G 2: 118,711,124 V975A probably benign Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp6r1 C T 7: 4,641,054 V430M possibly damaging Het
Ptges2 C A 2: 32,396,322 C16* probably null Het
Relb A T 7: 19,619,839 I38N probably damaging Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Samsn1 A G 16: 75,883,845 probably benign Het
Scrn1 A G 6: 54,520,769 V279A possibly damaging Het
Sec31b A G 19: 44,531,746 S200P probably benign Het
Selp A G 1: 164,144,906 T705A probably benign Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Slit3 G A 11: 35,651,820 probably null Het
Smo T A 6: 29,755,574 V415E probably damaging Het
Spag8 C A 4: 43,652,035 V350L possibly damaging Het
Tbck T G 3: 132,707,798 L132R possibly damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tm9sf2 T A 14: 122,149,840 probably null Het
Tmem131 A G 1: 36,841,676 V171A probably damaging Het
Tmem209 T C 6: 30,501,955 T83A probably benign Het
Tmem63a T C 1: 180,954,851 Y138H probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Trpv2 A G 11: 62,581,180 D66G possibly damaging Het
Trrap T A 5: 144,832,488 I2620N probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Ube2dnl1 G A X: 114,905,785 C119Y possibly damaging Het
Unc13c T A 9: 73,932,187 S461C probably damaging Het
Unc80 T G 1: 66,527,941 I902S probably damaging Het
Usp42 C A 5: 143,723,937 G170W probably damaging Het
Vldlr T C 19: 27,238,852 probably null Het
Ywhab A G 2: 164,015,345 Y180C probably damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp318 A G 17: 46,412,062 T1664A probably benign Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Zfp768 T C 7: 127,343,375 Q527R possibly damaging Het
Zfp975 T A 7: 42,665,146 probably null Het
Other mutations in Bglap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Bglap APN 3 88384350 critical splice donor site probably null
IGL02631:Bglap APN 3 88383680 nonsense probably null
IGL02738:Bglap APN 3 88384408 missense unknown
IGL03394:Bglap APN 3 88384005 missense probably benign 0.04
R0592:Bglap UTSW 3 88383655 missense probably benign 0.01
R1945:Bglap UTSW 3 88383664 missense probably damaging 1.00
R4067:Bglap UTSW 3 88384437 unclassified probably benign
R4796:Bglap UTSW 3 88384405 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGCTTGGCATCTGTAAAG -3'
(R):5'- ACAGCATCCTTTGGGTTTGACC -3'

Sequencing Primer
(F):5'- GCTTGGCATCTGTAAAGCAAAC -3'
(R):5'- GTTTGACCCACTGAGCACATG -3'
Posted On2016-02-04