Incidental Mutation 'R4795:Pdgfra'
ID368923
Institutional Source Beutler Lab
Gene Symbol Pdgfra
Ensembl Gene ENSMUSG00000029231
Gene Nameplatelet derived growth factor receptor, alpha polypeptide
SynonymsPdgfr-2, CD140a
MMRRC Submission 041996-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4795 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location75152292-75198215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75189311 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 952 (N952S)
Ref Sequence ENSEMBL: ENSMUSP00000127173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000476] [ENSMUST00000168162]
Predicted Effect probably benign
Transcript: ENSMUST00000000476
AA Change: N952S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000476
Gene: ENSMUSG00000029231
AA Change: N952S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168162
AA Change: N952S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127173
Gene: ENSMUSG00000029231
AA Change: N952S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (123/125)
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes for targeted null mutations exhibit incomplete cephalic closure, increased apoptosis of neural crest cells, impaired myotome and testis formation, abnormal mucosal linings, thoracic skeletal defects, and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,176,123 L2259R probably damaging Het
Acd A G 8: 105,701,015 S2P possibly damaging Het
Acsf3 A G 8: 122,780,157 Y63C possibly damaging Het
Adam21 T C 12: 81,560,974 I5V probably benign Het
Adamts6 C A 13: 104,444,128 S783* probably null Het
Adamtsl1 T C 4: 86,243,769 probably null Het
Adck2 T A 6: 39,576,393 S313T probably benign Het
Adgb A G 10: 10,357,872 I1285T probably benign Het
Angptl1 T A 1: 156,860,583 M485K possibly damaging Het
Ank3 G A 10: 69,858,265 V289I probably benign Het
Atp13a4 A G 16: 29,490,008 probably null Het
Atp1a1 A G 3: 101,583,775 L648P probably benign Het
Atp2a3 A G 11: 72,973,029 I194V probably benign Het
Bglap A C 3: 88,384,405 I4S unknown Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Ccdc112 T A 18: 46,287,672 Q337L probably benign Het
Cd34 T G 1: 194,951,011 S194A probably damaging Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Commd9 A G 2: 101,898,896 N116D probably benign Het
Dab2 C A 15: 6,429,611 P335T probably benign Het
Epb41l3 T A 17: 69,248,719 probably null Het
Epha2 A G 4: 141,322,416 probably null Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glyr1 A C 16: 5,047,758 V44G probably benign Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm18856 C A 13: 13,965,208 probably benign Het
Gm44501 A G 17: 40,578,714 K40E probably benign Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Hdhd5 T C 6: 120,523,446 H97R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hsf5 A G 11: 87,635,620 M373V probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Iigp1 T A 18: 60,389,892 F27L probably benign Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Kbtbd3 G A 9: 4,331,073 W482* probably null Het
Kcnq1 A G 7: 143,182,757 T168A probably benign Het
Lrch3 A G 16: 33,005,704 N631S probably damaging Het
Lrrk1 T A 7: 66,262,665 I1716F possibly damaging Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Map4 T C 9: 110,035,263 S519P probably benign Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc5b A G 7: 141,849,567 E755G unknown Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Necab1 G T 4: 15,111,208 D73E possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nfyb A T 10: 82,752,368 probably benign Het
Nol4 T C 18: 22,921,887 Q162R probably damaging Het
Nwd2 G A 5: 63,805,433 D787N probably benign Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr205 C T 16: 59,328,850 V220I probably benign Het
Olfr49 A G 14: 54,282,547 M116T probably damaging Het
Olfr535 A G 7: 140,493,007 D123G probably damaging Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr740 A C 14: 50,453,417 M122L probably damaging Het
Olfr908 T A 9: 38,516,503 M157K probably damaging Het
Orai3 T C 7: 127,773,888 V187A probably benign Het
Parn T C 16: 13,606,202 T444A probably benign Het
Pcdh11x A C X: 120,400,240 N460T probably damaging Het
Pcnt C T 10: 76,370,024 R2516H probably benign Het
Pde4d T A 13: 109,938,171 probably benign Het
Pgm1 A G 5: 64,103,874 Y237C probably damaging Het
Plcb2 A G 2: 118,711,124 V975A probably benign Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp6r1 C T 7: 4,641,054 V430M possibly damaging Het
Ptges2 C A 2: 32,396,322 C16* probably null Het
Relb A T 7: 19,619,839 I38N probably damaging Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Samsn1 A G 16: 75,883,845 probably benign Het
Scrn1 A G 6: 54,520,769 V279A possibly damaging Het
Sec31b A G 19: 44,531,746 S200P probably benign Het
Selp A G 1: 164,144,906 T705A probably benign Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Slit3 G A 11: 35,651,820 probably null Het
Smo T A 6: 29,755,574 V415E probably damaging Het
Spag8 C A 4: 43,652,035 V350L possibly damaging Het
Tbck T G 3: 132,707,798 L132R possibly damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tm9sf2 T A 14: 122,149,840 probably null Het
Tmem131 A G 1: 36,841,676 V171A probably damaging Het
Tmem209 T C 6: 30,501,955 T83A probably benign Het
Tmem63a T C 1: 180,954,851 Y138H probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Trpv2 A G 11: 62,581,180 D66G possibly damaging Het
Trrap T A 5: 144,832,488 I2620N probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Ube2dnl1 G A X: 114,905,785 C119Y possibly damaging Het
Unc13c T A 9: 73,932,187 S461C probably damaging Het
Unc80 T G 1: 66,527,941 I902S probably damaging Het
Usp42 C A 5: 143,723,937 G170W probably damaging Het
Vldlr T C 19: 27,238,852 probably null Het
Ywhab A G 2: 164,015,345 Y180C probably damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp318 A G 17: 46,412,062 T1664A probably benign Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Zfp768 T C 7: 127,343,375 Q527R possibly damaging Het
Zfp975 T A 7: 42,665,146 probably null Het
Other mutations in Pdgfra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pdgfra APN 5 75163679 missense probably benign 0.40
IGL00574:Pdgfra APN 5 75181047 missense probably damaging 1.00
IGL00906:Pdgfra APN 5 75180173 missense probably benign 0.00
IGL00964:Pdgfra APN 5 75175065 missense probably damaging 1.00
IGL01467:Pdgfra APN 5 75185631 critical splice donor site probably null
IGL01485:Pdgfra APN 5 75163652 missense probably benign 0.02
IGL01556:Pdgfra APN 5 75177691 missense probably damaging 1.00
IGL01949:Pdgfra APN 5 75170665 missense probably damaging 0.98
IGL02066:Pdgfra APN 5 75170580 missense possibly damaging 0.55
IGL02271:Pdgfra APN 5 75187906 missense probably damaging 1.00
IGL02726:Pdgfra APN 5 75194957 nonsense probably null
IGL02858:Pdgfra APN 5 75194974 missense probably damaging 1.00
IGL03306:Pdgfra APN 5 75192533 missense possibly damaging 0.49
Pony_express UTSW 5 75189234 nonsense probably null
P0033:Pdgfra UTSW 5 75192561 missense probably damaging 1.00
PIT4472001:Pdgfra UTSW 5 75180246 missense probably damaging 1.00
R0134:Pdgfra UTSW 5 75166511 missense probably damaging 1.00
R0200:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0254:Pdgfra UTSW 5 75167935 missense probably damaging 1.00
R0331:Pdgfra UTSW 5 75195052 missense probably damaging 1.00
R0467:Pdgfra UTSW 5 75195036 missense probably damaging 1.00
R0532:Pdgfra UTSW 5 75170773 missense probably benign 0.00
R0608:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0765:Pdgfra UTSW 5 75187987 unclassified probably benign
R1171:Pdgfra UTSW 5 75173447 missense probably damaging 0.98
R1372:Pdgfra UTSW 5 75189263 missense probably damaging 0.96
R1530:Pdgfra UTSW 5 75189010 splice site probably null
R1585:Pdgfra UTSW 5 75192603 missense probably damaging 1.00
R1666:Pdgfra UTSW 5 75189020 missense possibly damaging 0.94
R1836:Pdgfra UTSW 5 75183014 missense possibly damaging 0.95
R1868:Pdgfra UTSW 5 75170873 missense probably benign 0.43
R1923:Pdgfra UTSW 5 75163733 missense probably benign 0.03
R2075:Pdgfra UTSW 5 75187948 missense probably damaging 1.00
R2261:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R2262:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R3028:Pdgfra UTSW 5 75174981 missense probably damaging 1.00
R3236:Pdgfra UTSW 5 75167936 missense probably damaging 1.00
R3692:Pdgfra UTSW 5 75189287 missense possibly damaging 0.54
R3701:Pdgfra UTSW 5 75180220 nonsense probably null
R3890:Pdgfra UTSW 5 75167927 missense probably null 0.57
R3901:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R3902:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R4272:Pdgfra UTSW 5 75183070 missense probably benign 0.05
R4532:Pdgfra UTSW 5 75181083 missense probably damaging 1.00
R4660:Pdgfra UTSW 5 75162271 missense possibly damaging 0.82
R4753:Pdgfra UTSW 5 75181524 missense probably damaging 1.00
R4796:Pdgfra UTSW 5 75189311 missense probably benign
R4884:Pdgfra UTSW 5 75189312 missense probably benign 0.07
R4936:Pdgfra UTSW 5 75195026 missense probably damaging 1.00
R5625:Pdgfra UTSW 5 75189337 critical splice donor site probably null
R5666:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5670:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5714:Pdgfra UTSW 5 75186012 missense probably damaging 1.00
R5836:Pdgfra UTSW 5 75163774 missense possibly damaging 0.52
R6126:Pdgfra UTSW 5 75170529 missense probably benign 0.09
R6141:Pdgfra UTSW 5 75173396 missense probably damaging 0.98
R6297:Pdgfra UTSW 5 75173474 missense possibly damaging 0.88
R6363:Pdgfra UTSW 5 75170836 missense possibly damaging 0.91
R6376:Pdgfra UTSW 5 75166519 missense probably benign 0.02
R6485:Pdgfra UTSW 5 75175074 splice site probably null
R6612:Pdgfra UTSW 5 75167842 missense probably benign 0.01
R6641:Pdgfra UTSW 5 75162101 intron probably benign
R6954:Pdgfra UTSW 5 75173394 missense possibly damaging 0.82
R7110:Pdgfra UTSW 5 75189234 nonsense probably null
R7192:Pdgfra UTSW 5 75183106 missense probably damaging 1.00
R7294:Pdgfra UTSW 5 75181651 missense probably benign 0.05
R7347:Pdgfra UTSW 5 75183098 missense possibly damaging 0.91
R7476:Pdgfra UTSW 5 75170603 missense probably damaging 1.00
Z1088:Pdgfra UTSW 5 75166577 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTGAAGTGTGAGCTTCCTCC -3'
(R):5'- AGTGCTACTGGGGTCCTATAG -3'

Sequencing Primer
(F):5'- GAGCTTCCTCCTCACCCACG -3'
(R):5'- GGGGTCCTATAGAGCACTCC -3'
Posted On2016-02-04