Incidental Mutation 'R4795:Adamts6'
ID368969
Institutional Source Beutler Lab
Gene Symbol Adamts6
Ensembl Gene ENSMUSG00000046169
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6
Synonymsb2b2187.1Clo, b2b2182Clo, ADAM-TS6, b2b2029Clo, b2b1879.1Clo, b2b2228Clo, A930019D11Rik
MMRRC Submission 041996-MU
Accession Numbers

NCBI RefSeq: NM_001081020.1; MGI: 1347348

Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R4795 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location104287835-104496695 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 104444128 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 783 (S783*)
Ref Sequence ENSEMBL: ENSMUSP00000153359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065766] [ENSMUST00000223562] [ENSMUST00000224208] [ENSMUST00000224303] [ENSMUST00000224742] [ENSMUST00000224784]
Predicted Effect probably null
Transcript: ENSMUST00000065766
AA Change: S783*
SMART Domains Protein: ENSMUSP00000064570
Gene: ENSMUSG00000046169
AA Change: S783*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 191 4.2e-40 PFAM
Pfam:Reprolysin_5 248 443 3.8e-17 PFAM
Pfam:Reprolysin_4 248 464 4.9e-12 PFAM
Pfam:Reprolysin 250 468 1.6e-27 PFAM
Pfam:Reprolysin_2 268 458 5.6e-15 PFAM
Pfam:Reprolysin_3 272 414 2.6e-14 PFAM
TSP1 561 613 3.98e-13 SMART
Pfam:ADAM_spacer1 717 829 2.9e-41 PFAM
TSP1 843 900 2.49e-5 SMART
TSP1 902 960 2.87e-5 SMART
TSP1 963 1018 1.36e-1 SMART
TSP1 1021 1069 2.36e-6 SMART
Pfam:PLAC 1083 1115 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223562
Predicted Effect probably null
Transcript: ENSMUST00000224208
AA Change: S783*
Predicted Effect probably benign
Transcript: ENSMUST00000224303
Predicted Effect probably benign
Transcript: ENSMUST00000224742
Predicted Effect probably benign
Transcript: ENSMUST00000224784
Meta Mutation Damage Score 0.6504 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (123/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Expression of this gene may be regulated by the cytokine TNF-alpha. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for induced mutations exhibit cardiovascular defects including double outlet right ventricle, ventricular septal defects and biventricular hypertrophy, and hydrops, thymus hypoplasia short snout and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,176,123 L2259R probably damaging Het
Acd A G 8: 105,701,015 S2P possibly damaging Het
Acsf3 A G 8: 122,780,157 Y63C possibly damaging Het
Adam21 T C 12: 81,560,974 I5V probably benign Het
Adamtsl1 T C 4: 86,243,769 probably null Het
Adck2 T A 6: 39,576,393 S313T probably benign Het
Adgb A G 10: 10,357,872 I1285T probably benign Het
Angptl1 T A 1: 156,860,583 M485K possibly damaging Het
Ank3 G A 10: 69,858,265 V289I probably benign Het
Atp13a4 A G 16: 29,490,008 probably null Het
Atp1a1 A G 3: 101,583,775 L648P probably benign Het
Atp2a3 A G 11: 72,973,029 I194V probably benign Het
Bglap A C 3: 88,384,405 I4S unknown Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Ccdc112 T A 18: 46,287,672 Q337L probably benign Het
Cd34 T G 1: 194,951,011 S194A probably damaging Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Commd9 A G 2: 101,898,896 N116D probably benign Het
Dab2 C A 15: 6,429,611 P335T probably benign Het
Epb41l3 T A 17: 69,248,719 probably null Het
Epha2 A G 4: 141,322,416 probably null Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glyr1 A C 16: 5,047,758 V44G probably benign Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm18856 C A 13: 13,965,208 probably benign Het
Gm44501 A G 17: 40,578,714 K40E probably benign Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Hdhd5 T C 6: 120,523,446 H97R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hsf5 A G 11: 87,635,620 M373V probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Iigp1 T A 18: 60,389,892 F27L probably benign Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Kbtbd3 G A 9: 4,331,073 W482* probably null Het
Kcnq1 A G 7: 143,182,757 T168A probably benign Het
Lrch3 A G 16: 33,005,704 N631S probably damaging Het
Lrrk1 T A 7: 66,262,665 I1716F possibly damaging Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Map4 T C 9: 110,035,263 S519P probably benign Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc5b A G 7: 141,849,567 E755G unknown Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Necab1 G T 4: 15,111,208 D73E possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nfyb A T 10: 82,752,368 probably benign Het
Nol4 T C 18: 22,921,887 Q162R probably damaging Het
Nwd2 G A 5: 63,805,433 D787N probably benign Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr205 C T 16: 59,328,850 V220I probably benign Het
Olfr49 A G 14: 54,282,547 M116T probably damaging Het
Olfr535 A G 7: 140,493,007 D123G probably damaging Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr740 A C 14: 50,453,417 M122L probably damaging Het
Olfr908 T A 9: 38,516,503 M157K probably damaging Het
Orai3 T C 7: 127,773,888 V187A probably benign Het
Parn T C 16: 13,606,202 T444A probably benign Het
Pcdh11x A C X: 120,400,240 N460T probably damaging Het
Pcnt C T 10: 76,370,024 R2516H probably benign Het
Pde4d T A 13: 109,938,171 probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Pgm1 A G 5: 64,103,874 Y237C probably damaging Het
Plcb2 A G 2: 118,711,124 V975A probably benign Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp6r1 C T 7: 4,641,054 V430M possibly damaging Het
Ptges2 C A 2: 32,396,322 C16* probably null Het
Relb A T 7: 19,619,839 I38N probably damaging Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Samsn1 A G 16: 75,883,845 probably benign Het
Scrn1 A G 6: 54,520,769 V279A possibly damaging Het
Sec31b A G 19: 44,531,746 S200P probably benign Het
Selp A G 1: 164,144,906 T705A probably benign Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Slit3 G A 11: 35,651,820 probably null Het
Smo T A 6: 29,755,574 V415E probably damaging Het
Spag8 C A 4: 43,652,035 V350L possibly damaging Het
Tbck T G 3: 132,707,798 L132R possibly damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tm9sf2 T A 14: 122,149,840 probably null Het
Tmem131 A G 1: 36,841,676 V171A probably damaging Het
Tmem209 T C 6: 30,501,955 T83A probably benign Het
Tmem63a T C 1: 180,954,851 Y138H probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Trpv2 A G 11: 62,581,180 D66G possibly damaging Het
Trrap T A 5: 144,832,488 I2620N probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Ube2dnl1 G A X: 114,905,785 C119Y possibly damaging Het
Unc13c T A 9: 73,932,187 S461C probably damaging Het
Unc80 T G 1: 66,527,941 I902S probably damaging Het
Usp42 C A 5: 143,723,937 G170W probably damaging Het
Vldlr T C 19: 27,238,852 probably null Het
Ywhab A G 2: 164,015,345 Y180C probably damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp318 A G 17: 46,412,062 T1664A probably benign Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Zfp768 T C 7: 127,343,375 Q527R possibly damaging Het
Zfp975 T A 7: 42,665,146 probably null Het
Other mutations in Adamts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Adamts6 APN 13 104429790 missense possibly damaging 0.79
IGL00583:Adamts6 APN 13 104297218 nonsense probably null
IGL01305:Adamts6 APN 13 104390082 missense probably damaging 1.00
IGL01448:Adamts6 APN 13 104297164 missense probably damaging 1.00
IGL01517:Adamts6 APN 13 104390192 splice site probably benign
IGL01678:Adamts6 APN 13 104313688 missense probably damaging 1.00
IGL01737:Adamts6 APN 13 104390135 missense probably damaging 0.99
IGL02152:Adamts6 APN 13 104313660 missense probably null 1.00
IGL02217:Adamts6 APN 13 104462365 splice site probably benign
IGL02828:Adamts6 APN 13 104297470 missense probably damaging 1.00
IGL03067:Adamts6 APN 13 104297275 missense probably damaging 1.00
IGL03081:Adamts6 APN 13 104444956 utr 3 prime probably benign
IGL03159:Adamts6 APN 13 104444215 missense probably damaging 1.00
IGL03411:Adamts6 APN 13 104314334 missense possibly damaging 0.77
ANU22:Adamts6 UTSW 13 104390082 missense probably damaging 1.00
P0007:Adamts6 UTSW 13 104297491 missense possibly damaging 0.73
R0362:Adamts6 UTSW 13 104390076 critical splice acceptor site probably null
R0504:Adamts6 UTSW 13 104426930 splice site probably benign
R0549:Adamts6 UTSW 13 104297255 missense possibly damaging 0.60
R0566:Adamts6 UTSW 13 104444927 missense probably benign 0.00
R0703:Adamts6 UTSW 13 104352847 missense probably damaging 1.00
R0799:Adamts6 UTSW 13 104314271 missense probably damaging 1.00
R0838:Adamts6 UTSW 13 104413789 missense possibly damaging 0.47
R1500:Adamts6 UTSW 13 104312881 missense probably damaging 1.00
R1502:Adamts6 UTSW 13 104493637 missense probably damaging 1.00
R1547:Adamts6 UTSW 13 104444875 missense probably benign 0.26
R1619:Adamts6 UTSW 13 104312777 missense probably benign 0.14
R1727:Adamts6 UTSW 13 104428964 splice site probably benign
R1967:Adamts6 UTSW 13 104426951 nonsense probably null
R2013:Adamts6 UTSW 13 104314304 missense probably damaging 0.98
R2079:Adamts6 UTSW 13 104462238 missense probably benign 0.00
R2432:Adamts6 UTSW 13 104426977 missense probably benign 0.01
R3118:Adamts6 UTSW 13 104314279 missense possibly damaging 0.91
R4125:Adamts6 UTSW 13 104312904 missense probably damaging 1.00
R4274:Adamts6 UTSW 13 104314279 missense possibly damaging 0.91
R4841:Adamts6 UTSW 13 104312787 missense probably benign 0.00
R4976:Adamts6 UTSW 13 104297490 missense probably damaging 0.98
R5085:Adamts6 UTSW 13 104307243 missense probably damaging 0.99
R5234:Adamts6 UTSW 13 104493622 missense probably damaging 1.00
R5403:Adamts6 UTSW 13 104352815 missense possibly damaging 0.86
R5753:Adamts6 UTSW 13 104347350 missense probably damaging 1.00
R6027:Adamts6 UTSW 13 104479535 missense probably damaging 1.00
R6187:Adamts6 UTSW 13 104297425 missense probably damaging 1.00
R6229:Adamts6 UTSW 13 104347392 critical splice donor site probably null
R6243:Adamts6 UTSW 13 104314301 missense probably damaging 0.99
R6257:Adamts6 UTSW 13 104462282 missense probably benign
R6743:Adamts6 UTSW 13 104428928 missense probably damaging 1.00
R6775:Adamts6 UTSW 13 104313652 missense probably damaging 0.97
R7113:Adamts6 UTSW 13 104312759 missense probably benign
R7351:Adamts6 UTSW 13 104390112 missense possibly damaging 0.63
X0065:Adamts6 UTSW 13 104493628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGAAAATGGCCTAGCATC -3'
(R):5'- GAGACCTATGGCCTTTACTCTG -3'

Sequencing Primer
(F):5'- CTATAATGCATAGTTGATACACG -3'
(R):5'- TTCCATCACCTGTAAAAGAGAGCTG -3'
Posted On2016-02-04