Incidental Mutation 'R0418:Dpp9'
ID36898
Institutional Source Beutler Lab
Gene Symbol Dpp9
Ensembl Gene ENSMUSG00000001229
Gene Namedipeptidylpeptidase 9
SynonymsDPRP2, 6430584G11Rik
MMRRC Submission 038620-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0418 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56186807-56218889 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 56194404 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038794]
Predicted Effect probably benign
Transcript: ENSMUST00000038794
SMART Domains Protein: ENSMUSP00000046604
Gene: ENSMUSG00000001229

DomainStartEndE-ValueType
low complexity region 122 133 N/A INTRINSIC
Pfam:DPPIV_N 145 569 5.2e-109 PFAM
Pfam:Peptidase_S15 617 793 2.8e-10 PFAM
Pfam:Peptidase_S9 657 862 2.5e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223616
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the S9B family in clan SC of the serine proteases. The protein has been shown to have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Although the activity of this protein is similar to that of dipeptidyl peptidase 4 (DPP4), it does not appear to be membrane bound. In general, dipeptidyl peptidases appear to be involved in the regulation of the activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. Several transcript variants of this gene have been described but not fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants display partial neonatal lethality and complete lethality at preweaning stages with defects suckling due to undeveveloped tongue muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik G T 2: 104,123,330 probably null Het
Abca14 T C 7: 120,207,434 L19P probably damaging Het
Abcb1a T A 5: 8,713,281 V603E probably damaging Het
Acsl5 A G 19: 55,272,806 D65G probably benign Het
Acss3 T C 10: 107,023,912 Y311C probably damaging Het
Ak8 T G 2: 28,733,856 I151S possibly damaging Het
Aldh1a1 T C 19: 20,629,049 probably benign Het
Aldh1l1 A G 6: 90,569,893 R393G possibly damaging Het
Ankhd1 T A 18: 36,634,300 L1164Q probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atf5 A G 7: 44,813,397 M101T possibly damaging Het
C77080 A G 4: 129,223,684 S396P probably damaging Het
Det1 T C 7: 78,844,017 T80A probably benign Het
Fam13c A G 10: 70,534,761 R244G probably damaging Het
Fat3 A T 9: 16,246,896 N1139K probably damaging Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fli1 T C 9: 32,452,129 probably benign Het
Glb1l2 T G 9: 26,794,101 D151A probably damaging Het
Gli2 G A 1: 118,840,490 T669I possibly damaging Het
Igsf3 C A 3: 101,435,435 R463S probably damaging Het
Il1rl2 T C 1: 40,326,502 V3A unknown Het
Irx3 G A 8: 91,800,080 S332F probably benign Het
Katnb1 C T 8: 95,095,658 T303M possibly damaging Het
Lrrc31 A T 3: 30,689,234 L194Q probably damaging Het
Lrrc37a T G 11: 103,503,438 E387A probably benign Het
Mapk14 T C 17: 28,691,789 I17T probably benign Het
Mtif2 A G 11: 29,533,401 probably benign Het
Myo16 A G 8: 10,569,918 T1490A probably benign Het
Nfasc A G 1: 132,611,595 V399A probably damaging Het
Nobox T C 6: 43,307,235 K1E probably null Het
Nr2c1 A T 10: 94,181,512 M371L probably benign Het
Olfr1330 C T 4: 118,893,251 T56I possibly damaging Het
Olfr642 G A 7: 104,049,772 T194I probably benign Het
Oplah C T 15: 76,298,487 R924H probably benign Het
Pappa2 C A 1: 158,716,990 C1756F probably damaging Het
Pdzd8 G A 19: 59,300,929 R680C probably damaging Het
Rassf3 G A 10: 121,417,170 T44M probably benign Het
Rmnd1 T C 10: 4,427,693 probably null Het
Rnf126 C T 10: 79,762,643 probably benign Het
Rnf144b T C 13: 47,244,490 S299P probably benign Het
Ryr2 A G 13: 11,834,095 probably benign Het
Scel T A 14: 103,603,254 S511T probably benign Het
Slc16a10 G T 10: 40,040,631 S138* probably null Het
Slc36a4 A T 9: 15,734,266 I330F probably damaging Het
Slc5a8 A G 10: 88,886,558 I84M probably benign Het
Spag9 T C 11: 94,091,753 probably benign Het
Suco C T 1: 161,834,850 V671I probably benign Het
Suox G A 10: 128,670,885 P425S probably damaging Het
Tmem266 T A 9: 55,437,413 V443E probably benign Het
Tmprss11f A T 5: 86,557,011 I16N probably benign Het
Tnik T A 3: 28,570,880 Y321* probably null Het
Tnrc6b T C 15: 80,913,323 M1357T probably benign Het
Tpbg C A 9: 85,844,750 Y257* probably null Het
Usp37 A T 1: 74,490,107 S138T probably benign Het
Veph1 T A 3: 66,255,028 R70* probably null Het
Vmn2r17 C T 5: 109,452,881 P682S probably damaging Het
Vmn2r79 A C 7: 87,002,403 N337H probably benign Het
Vstm2b A G 7: 40,902,452 D68G probably damaging Het
Vwa7 G T 17: 35,017,957 A167S possibly damaging Het
Zfp647 A T 15: 76,911,386 I358N probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Dpp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Dpp9 APN 17 56205240 missense probably damaging 0.99
IGL00920:Dpp9 APN 17 56200599 missense probably benign 0.01
IGL01568:Dpp9 APN 17 56191159 missense probably benign
IGL01583:Dpp9 APN 17 56211666 missense probably benign 0.00
IGL01613:Dpp9 APN 17 56190713 missense probably benign
IGL03371:Dpp9 APN 17 56187377 missense probably benign 0.00
R0100:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R0100:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R1163:Dpp9 UTSW 17 56199426 missense possibly damaging 0.90
R1680:Dpp9 UTSW 17 56190103 missense probably benign 0.00
R1709:Dpp9 UTSW 17 56194431 missense probably benign
R1762:Dpp9 UTSW 17 56188362 missense probably damaging 1.00
R1809:Dpp9 UTSW 17 56199038 missense probably damaging 1.00
R1853:Dpp9 UTSW 17 56202885 missense probably benign 0.00
R1854:Dpp9 UTSW 17 56202885 missense probably benign 0.00
R2162:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R2205:Dpp9 UTSW 17 56199287 missense possibly damaging 0.87
R2301:Dpp9 UTSW 17 56194973 missense probably benign 0.00
R2520:Dpp9 UTSW 17 56206868 missense probably damaging 1.00
R3831:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R3833:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R4364:Dpp9 UTSW 17 56187391 missense possibly damaging 0.79
R4737:Dpp9 UTSW 17 56198970 critical splice donor site probably null
R4740:Dpp9 UTSW 17 56198970 critical splice donor site probably null
R4741:Dpp9 UTSW 17 56205286 missense probably benign
R4798:Dpp9 UTSW 17 56191016 missense probably damaging 0.96
R4806:Dpp9 UTSW 17 56190030 missense probably damaging 1.00
R5375:Dpp9 UTSW 17 56189424 nonsense probably null
R5709:Dpp9 UTSW 17 56189393 missense probably benign
R5783:Dpp9 UTSW 17 56211655 missense probably damaging 0.98
R6454:Dpp9 UTSW 17 56206808 missense probably damaging 1.00
R6532:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R6894:Dpp9 UTSW 17 56188321 missense probably damaging 1.00
X0065:Dpp9 UTSW 17 56195006 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCTCAGAGGCACTGTCACAAC -3'
(R):5'- GATGCCTGTCCATTGAGGACGAAG -3'

Sequencing Primer
(F):5'- ACCATTACCCCAGGGTGC -3'
(R):5'- AGGTTCGTCACCTGCAAAG -3'
Posted On2013-05-09