Incidental Mutation 'R4796:Pdgfra'
ID369035
Institutional Source Beutler Lab
Gene Symbol Pdgfra
Ensembl Gene ENSMUSG00000029231
Gene Nameplatelet derived growth factor receptor, alpha polypeptide
SynonymsPdgfr-2, CD140a
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4796 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location75152292-75198215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75189311 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 952 (N952S)
Ref Sequence ENSEMBL: ENSMUSP00000127173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000476] [ENSMUST00000168162]
Predicted Effect probably benign
Transcript: ENSMUST00000000476
AA Change: N952S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000476
Gene: ENSMUSG00000029231
AA Change: N952S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168162
AA Change: N952S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127173
Gene: ENSMUSG00000029231
AA Change: N952S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes for targeted null mutations exhibit incomplete cephalic closure, increased apoptosis of neural crest cells, impaired myotome and testis formation, abnormal mucosal linings, thoracic skeletal defects, and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A G 2: 148,850,738 F48S probably damaging Het
9930021J03Rik G A 19: 29,753,618 H665Y probably benign Het
Adgrv1 C T 13: 81,155,231 W132* probably null Het
Atp8b3 A G 10: 80,524,354 V961A probably damaging Het
Bglap A C 3: 88,384,405 I4S unknown Het
Bmp1 T C 14: 70,492,073 probably null Het
Btaf1 T C 19: 36,956,428 L152P possibly damaging Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Capn3 A T 2: 120,502,998 N621I probably damaging Het
Ccdc59 T C 10: 105,841,568 S23P probably benign Het
Cd22 A T 7: 30,872,956 probably null Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Cep112 T C 11: 108,486,992 probably null Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Coq10b A G 1: 55,071,798 T242A probably damaging Het
Ctnnd1 G T 2: 84,619,926 R317S probably damaging Het
Dlg5 G A 14: 24,144,383 H1674Y probably damaging Het
Drc3 C A 11: 60,363,528 N75K probably damaging Het
Efna4 T C 3: 89,335,248 E113G probably damaging Het
Egr3 C A 14: 70,077,575 A44D probably benign Het
Ercc3 T C 18: 32,248,310 F393S probably damaging Het
Evi2 T A 11: 79,515,447 probably benign Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Farsb A T 1: 78,425,196 *590R probably null Het
Fat3 A G 9: 15,999,732 M1658T probably benign Het
Fhod3 G T 18: 24,985,301 V232F probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fzd3 A G 14: 65,235,158 V387A possibly damaging Het
Gm14085 T A 2: 122,514,459 I182N probably damaging Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Gm7964 A G 7: 83,755,901 probably null Het
Hbs1l G T 10: 21,342,506 G301C probably damaging Het
Hipk4 A G 7: 27,528,570 H247R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hoxa5 C T 6: 52,203,963 A130T probably benign Het
Igf2r C T 17: 12,684,126 V2346I possibly damaging Het
Igsf8 T C 1: 172,316,322 V14A probably benign Het
Impg1 G A 9: 80,394,095 P183L probably damaging Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Itgb5 T C 16: 33,885,021 V227A possibly damaging Het
Jph4 G T 14: 55,109,708 P461T probably damaging Het
Kcnab1 T A 3: 65,304,165 probably null Het
Klrc1 T A 6: 129,677,762 probably null Het
Lonrf2 A T 1: 38,816,038 L92Q probably benign Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mapk13 T C 17: 28,775,554 Y140H probably damaging Het
Mgat4d A G 8: 83,358,120 E164G probably damaging Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mthfs A T 9: 89,240,025 H188L probably benign Het
Muc5b T A 7: 141,864,246 M3643K possibly damaging Het
Mylk3 T C 8: 85,350,385 Y474C probably damaging Het
Myo5b A G 18: 74,744,630 T1567A possibly damaging Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nxph2 C T 2: 23,399,858 T74M probably benign Het
Ogdh T A 11: 6,340,570 M385K probably benign Het
Olfr1239 T C 2: 89,417,891 H174R probably damaging Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr402 A T 11: 74,155,591 I146F probably benign Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr830 T C 9: 18,876,179 V284A probably damaging Het
Olfr921 T A 9: 38,775,374 F40I probably benign Het
Pcsk2 A C 2: 143,813,425 I510L probably benign Het
Pex26 T C 6: 121,193,557 F287S probably damaging Het
Pick1 G C 15: 79,255,610 probably benign Het
Plxnb1 G T 9: 109,114,595 V1917L probably damaging Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp1r10 T G 17: 35,924,087 I61R probably damaging Het
Prex1 A T 2: 166,592,291 L503Q probably damaging Het
Ptp4a1 A C 1: 30,943,938 I133R probably damaging Het
Rassf10 G T 7: 112,954,528 R112L probably damaging Het
Ripor3 T A 2: 167,981,340 I884F probably damaging Het
Rnft2 A G 5: 118,201,246 Y369H probably damaging Het
Rtp3 A T 9: 110,986,454 V281E probably benign Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Selp A G 1: 164,144,906 T705A probably benign Het
Sgca A T 11: 94,970,727 probably null Het
Slc22a3 T C 17: 12,423,788 E514G probably damaging Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Smarcal1 G A 1: 72,597,440 V425I probably benign Het
Soga1 A G 2: 157,020,252 S1586P probably benign Het
Ssx2ip T C 3: 146,418,359 V43A probably benign Het
Synpo A G 18: 60,604,314 S187P probably damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tldc1 A T 8: 119,768,354 S222T probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Upk1b T C 16: 38,787,242 H41R probably benign Het
Vmn2r76 T C 7: 86,230,444 D216G possibly damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zfp383 A C 7: 29,914,838 T173P possibly damaging Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Other mutations in Pdgfra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pdgfra APN 5 75163679 missense probably benign 0.40
IGL00574:Pdgfra APN 5 75181047 missense probably damaging 1.00
IGL00906:Pdgfra APN 5 75180173 missense probably benign 0.00
IGL00964:Pdgfra APN 5 75175065 missense probably damaging 1.00
IGL01467:Pdgfra APN 5 75185631 critical splice donor site probably null
IGL01485:Pdgfra APN 5 75163652 missense probably benign 0.02
IGL01556:Pdgfra APN 5 75177691 missense probably damaging 1.00
IGL01949:Pdgfra APN 5 75170665 missense probably damaging 0.98
IGL02066:Pdgfra APN 5 75170580 missense possibly damaging 0.55
IGL02271:Pdgfra APN 5 75187906 missense probably damaging 1.00
IGL02726:Pdgfra APN 5 75194957 nonsense probably null
IGL02858:Pdgfra APN 5 75194974 missense probably damaging 1.00
IGL03306:Pdgfra APN 5 75192533 missense possibly damaging 0.49
P0033:Pdgfra UTSW 5 75192561 missense probably damaging 1.00
R0134:Pdgfra UTSW 5 75166511 missense probably damaging 1.00
R0200:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0254:Pdgfra UTSW 5 75167935 missense probably damaging 1.00
R0331:Pdgfra UTSW 5 75195052 missense probably damaging 1.00
R0467:Pdgfra UTSW 5 75195036 missense probably damaging 1.00
R0532:Pdgfra UTSW 5 75170773 missense probably benign 0.00
R0608:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0765:Pdgfra UTSW 5 75187987 unclassified probably benign
R1171:Pdgfra UTSW 5 75173447 missense probably damaging 0.98
R1372:Pdgfra UTSW 5 75189263 missense probably damaging 0.96
R1530:Pdgfra UTSW 5 75189010 splice site probably null
R1585:Pdgfra UTSW 5 75192603 missense probably damaging 1.00
R1666:Pdgfra UTSW 5 75189020 missense possibly damaging 0.94
R1836:Pdgfra UTSW 5 75183014 missense possibly damaging 0.95
R1868:Pdgfra UTSW 5 75170873 missense probably benign 0.43
R1923:Pdgfra UTSW 5 75163733 missense probably benign 0.03
R2075:Pdgfra UTSW 5 75187948 missense probably damaging 1.00
R2261:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R2262:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R3028:Pdgfra UTSW 5 75174981 missense probably damaging 1.00
R3236:Pdgfra UTSW 5 75167936 missense probably damaging 1.00
R3692:Pdgfra UTSW 5 75189287 missense possibly damaging 0.54
R3701:Pdgfra UTSW 5 75180220 nonsense probably null
R3890:Pdgfra UTSW 5 75167927 missense probably null 0.57
R3901:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R3902:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R4272:Pdgfra UTSW 5 75183070 missense probably benign 0.05
R4532:Pdgfra UTSW 5 75181083 missense probably damaging 1.00
R4660:Pdgfra UTSW 5 75162271 missense possibly damaging 0.82
R4753:Pdgfra UTSW 5 75181524 missense probably damaging 1.00
R4795:Pdgfra UTSW 5 75189311 missense probably benign
R4884:Pdgfra UTSW 5 75189312 missense probably benign 0.07
R4936:Pdgfra UTSW 5 75195026 missense probably damaging 1.00
R5625:Pdgfra UTSW 5 75189337 critical splice donor site probably null
R5666:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5670:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5714:Pdgfra UTSW 5 75186012 missense probably damaging 1.00
R5836:Pdgfra UTSW 5 75163774 missense possibly damaging 0.52
R6126:Pdgfra UTSW 5 75170529 missense probably benign 0.09
R6141:Pdgfra UTSW 5 75173396 missense probably damaging 0.98
R6297:Pdgfra UTSW 5 75173474 missense possibly damaging 0.88
R6363:Pdgfra UTSW 5 75170836 missense possibly damaging 0.91
R6376:Pdgfra UTSW 5 75166519 missense probably benign 0.02
R6485:Pdgfra UTSW 5 75175074 splice site probably null
R6612:Pdgfra UTSW 5 75167842 missense probably benign 0.01
R6641:Pdgfra UTSW 5 75162101 intron probably benign
R6954:Pdgfra UTSW 5 75173394 missense possibly damaging 0.82
Z1088:Pdgfra UTSW 5 75166577 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGAAGTGTGAGCTTCCTCC -3'
(R):5'- AGTGCTACTGGGGTCCTATAGAG -3'

Sequencing Primer
(F):5'- GAGCTTCCTCCTCACCCACG -3'
(R):5'- GGGGTCCTATAGAGCACTCC -3'
Posted On2016-02-04