Incidental Mutation 'R4796:Btaf1'
ID369106
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene NameB-TFIID TATA-box binding protein associated factor 1
SynonymsE430027O22Rik
Accession Numbers

Genbank: NM_001080706

Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R4796 (G1)
Quality Score199
Status Not validated
Chromosome19
Chromosomal Location36926079-37012752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36956428 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 152 (L152P)
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099494
AA Change: L152P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: L152P

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A G 2: 148,850,738 F48S probably damaging Het
9930021J03Rik G A 19: 29,753,618 H665Y probably benign Het
Adgrv1 C T 13: 81,155,231 W132* probably null Het
Atp8b3 A G 10: 80,524,354 V961A probably damaging Het
Bglap A C 3: 88,384,405 I4S unknown Het
Bmp1 T C 14: 70,492,073 probably null Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Capn3 A T 2: 120,502,998 N621I probably damaging Het
Ccdc59 T C 10: 105,841,568 S23P probably benign Het
Cd22 A T 7: 30,872,956 probably null Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Cep112 T C 11: 108,486,992 probably null Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Coq10b A G 1: 55,071,798 T242A probably damaging Het
Ctnnd1 G T 2: 84,619,926 R317S probably damaging Het
Dlg5 G A 14: 24,144,383 H1674Y probably damaging Het
Drc3 C A 11: 60,363,528 N75K probably damaging Het
Efna4 T C 3: 89,335,248 E113G probably damaging Het
Egr3 C A 14: 70,077,575 A44D probably benign Het
Ercc3 T C 18: 32,248,310 F393S probably damaging Het
Evi2 T A 11: 79,515,447 probably benign Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Farsb A T 1: 78,425,196 *590R probably null Het
Fat3 A G 9: 15,999,732 M1658T probably benign Het
Fhod3 G T 18: 24,985,301 V232F probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fzd3 A G 14: 65,235,158 V387A possibly damaging Het
Gm14085 T A 2: 122,514,459 I182N probably damaging Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Gm7964 A G 7: 83,755,901 probably null Het
Hbs1l G T 10: 21,342,506 G301C probably damaging Het
Hipk4 A G 7: 27,528,570 H247R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hoxa5 C T 6: 52,203,963 A130T probably benign Het
Igf2r C T 17: 12,684,126 V2346I possibly damaging Het
Igsf8 T C 1: 172,316,322 V14A probably benign Het
Impg1 G A 9: 80,394,095 P183L probably damaging Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Itgb5 T C 16: 33,885,021 V227A possibly damaging Het
Jph4 G T 14: 55,109,708 P461T probably damaging Het
Kcnab1 T A 3: 65,304,165 probably null Het
Klrc1 T A 6: 129,677,762 probably null Het
Lonrf2 A T 1: 38,816,038 L92Q probably benign Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mapk13 T C 17: 28,775,554 Y140H probably damaging Het
Mgat4d A G 8: 83,358,120 E164G probably damaging Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mthfs A T 9: 89,240,025 H188L probably benign Het
Muc5b T A 7: 141,864,246 M3643K possibly damaging Het
Mylk3 T C 8: 85,350,385 Y474C probably damaging Het
Myo5b A G 18: 74,744,630 T1567A possibly damaging Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nxph2 C T 2: 23,399,858 T74M probably benign Het
Ogdh T A 11: 6,340,570 M385K probably benign Het
Olfr1239 T C 2: 89,417,891 H174R probably damaging Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr402 A T 11: 74,155,591 I146F probably benign Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr830 T C 9: 18,876,179 V284A probably damaging Het
Olfr921 T A 9: 38,775,374 F40I probably benign Het
Pcsk2 A C 2: 143,813,425 I510L probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Pex26 T C 6: 121,193,557 F287S probably damaging Het
Pick1 G C 15: 79,255,610 probably benign Het
Plxnb1 G T 9: 109,114,595 V1917L probably damaging Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp1r10 T G 17: 35,924,087 I61R probably damaging Het
Prex1 A T 2: 166,592,291 L503Q probably damaging Het
Ptp4a1 A C 1: 30,943,938 I133R probably damaging Het
Rassf10 G T 7: 112,954,528 R112L probably damaging Het
Ripor3 T A 2: 167,981,340 I884F probably damaging Het
Rnft2 A G 5: 118,201,246 Y369H probably damaging Het
Rtp3 A T 9: 110,986,454 V281E probably benign Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Selp A G 1: 164,144,906 T705A probably benign Het
Sgca A T 11: 94,970,727 probably null Het
Slc22a3 T C 17: 12,423,788 E514G probably damaging Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Smarcal1 G A 1: 72,597,440 V425I probably benign Het
Soga1 A G 2: 157,020,252 S1586P probably benign Het
Ssx2ip T C 3: 146,418,359 V43A probably benign Het
Synpo A G 18: 60,604,314 S187P probably damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tldc1 A T 8: 119,768,354 S222T probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Upk1b T C 16: 38,787,242 H41R probably benign Het
Vmn2r76 T C 7: 86,230,444 D216G possibly damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zfp383 A C 7: 29,914,838 T173P possibly damaging Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 37009702 missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36997535 missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36969930 missense probably benign 0.00
IGL00969:Btaf1 APN 19 37011252 splice site probably benign
IGL01325:Btaf1 APN 19 37004649 splice site probably benign
IGL01399:Btaf1 APN 19 37000170 nonsense probably null
IGL02024:Btaf1 APN 19 36992426 splice site probably benign
IGL02471:Btaf1 APN 19 37000192 missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36978428 splice site probably benign
IGL02898:Btaf1 APN 19 36969068 missense probably benign
IGL02995:Btaf1 APN 19 36981135 splice site probably benign
IGL03023:Btaf1 APN 19 37010015 missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36949108 missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36992500 missense probably damaging 1.00
freudenberg UTSW 19 36988173 critical splice donor site probably null
3-1:Btaf1 UTSW 19 37010078 missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36958373 missense probably benign
R0048:Btaf1 UTSW 19 37003524 missense probably benign 0.01
R0117:Btaf1 UTSW 19 36969968 missense probably benign 0.06
R0207:Btaf1 UTSW 19 37009648 nonsense probably null
R0310:Btaf1 UTSW 19 37004534 missense probably damaging 0.96
R0377:Btaf1 UTSW 19 36989002 missense probably benign
R0419:Btaf1 UTSW 19 36945229 missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36986653 missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36951186 splice site probably benign
R0612:Btaf1 UTSW 19 36969137 missense probably damaging 0.99
R0731:Btaf1 UTSW 19 36997495 splice site probably null
R0780:Btaf1 UTSW 19 36988922 missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36990743 missense probably benign 0.03
R1104:Btaf1 UTSW 19 37004602 missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36956524 missense probably benign 0.10
R1325:Btaf1 UTSW 19 36969162 missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36992454 missense probably benign 0.00
R1554:Btaf1 UTSW 19 36996598 missense probably benign 0.02
R1649:Btaf1 UTSW 19 36981722 missense probably benign
R1715:Btaf1 UTSW 19 36969121 missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36994962 missense probably benign
R1764:Btaf1 UTSW 19 36951118 missense probably benign 0.12
R1874:Btaf1 UTSW 19 36980583 missense probably benign
R1911:Btaf1 UTSW 19 36986630 missense probably benign
R1933:Btaf1 UTSW 19 36972957 missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36951148 missense probably benign 0.09
R2483:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R2510:Btaf1 UTSW 19 37002445 missense probably benign 0.08
R3623:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3624:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3801:Btaf1 UTSW 19 36986548 missense probably benign
R3801:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3802:Btaf1 UTSW 19 36986548 missense probably benign
R3802:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3803:Btaf1 UTSW 19 36986548 missense probably benign
R3803:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R4077:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4079:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4133:Btaf1 UTSW 19 36961738 missense probably benign 0.00
R4673:Btaf1 UTSW 19 36978372 missense probably benign 0.00
R4731:Btaf1 UTSW 19 36981078 missense probably benign 0.03
R4824:Btaf1 UTSW 19 36981048 missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 37002458 missense probably benign 0.00
R4837:Btaf1 UTSW 19 36966785 missense probably benign
R4925:Btaf1 UTSW 19 37011333 missense probably benign
R4968:Btaf1 UTSW 19 36969951 missense probably null 0.71
R4976:Btaf1 UTSW 19 36986579 missense probably benign
R5001:Btaf1 UTSW 19 36986652 missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 37003531 missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36990762 missense probably benign
R5211:Btaf1 UTSW 19 36996562 missense probably benign 0.32
R5422:Btaf1 UTSW 19 36951107 missense probably benign 0.09
R5429:Btaf1 UTSW 19 36994857 missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36990775 missense possibly damaging 0.85
R5582:Btaf1 UTSW 19 36988173 critical splice donor site probably null
R5654:Btaf1 UTSW 19 36983615 missense probably benign 0.35
R5744:Btaf1 UTSW 19 37004490 missense probably benign 0.02
R6082:Btaf1 UTSW 19 36983542 missense probably damaging 1.00
R6243:Btaf1 UTSW 19 36981120 missense probably benign 0.02
R6291:Btaf1 UTSW 19 36973008 missense probably benign 0.00
R6502:Btaf1 UTSW 19 36983617 missense probably benign
R7034:Btaf1 UTSW 19 37004469 missense probably benign
R7036:Btaf1 UTSW 19 37004469 missense probably benign
R7085:Btaf1 UTSW 19 36972918 missense probably benign
R7097:Btaf1 UTSW 19 36949102 missense probably damaging 1.00
W0251:Btaf1 UTSW 19 37003504 missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36949096 nonsense probably null
Z1088:Btaf1 UTSW 19 36986618 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTGCCACTCTGCCTGTCT -3'
(R):5'- ACGAGTAGATGTAAGCACAGC -3'

Sequencing Primer
(F):5'- CTCAACTGTGTAGCCTAGACTGG -3'
(R):5'- GTAAGCACAGCATTTTTCTTGTGC -3'
Posted On2016-02-04