Incidental Mutation 'R4797:Spag17'
ID369119
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Namesperm associated antigen 17
Synonyms4931427F14Rik, PF6
MMRRC Submission 042421-MU
Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R4797 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location99885406-100143322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99984479 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 216 (D216E)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164539
AA Change: D216E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: D216E

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,118,119 T1195A probably benign Het
Apobr G A 7: 126,587,584 E756K probably benign Het
Arpc3 A G 5: 122,404,152 E77G possibly damaging Het
Atp2b2 A T 6: 113,789,886 M464K possibly damaging Het
Atxn7l2 A G 3: 108,204,550 S379P probably damaging Het
Ccdc91 A T 6: 147,592,143 E344D unknown Het
Cdc42bpg G A 19: 6,320,447 R1190Q probably damaging Het
Cdh17 C A 4: 11,810,390 Q694K probably benign Het
Chordc1 G T 9: 18,292,376 probably benign Het
Copg1 A G 6: 87,903,468 probably benign Het
Dcbld1 T C 10: 52,284,127 V37A probably damaging Het
Ddb2 A G 2: 91,236,818 probably benign Het
Dok5 A T 2: 170,830,122 R115* probably null Het
Drc7 T C 8: 95,074,297 I649T probably damaging Het
E130309D02Rik A G 5: 143,311,749 F181S probably benign Het
Efr3a A G 15: 65,857,588 T713A probably damaging Het
Epg5 G A 18: 78,030,399 D2494N probably benign Het
Eps15 G A 4: 109,366,530 probably benign Het
Glb1l3 T C 9: 26,828,446 D356G probably damaging Het
Gm10639 A T 9: 78,304,397 Y147F probably benign Het
Gm1818 A T 12: 48,555,610 noncoding transcript Het
Gm4450 T A 3: 98,456,431 R62* probably null Het
Hcrtr2 C A 9: 76,254,534 M191I probably damaging Het
Heatr1 G A 13: 12,412,048 E685K probably benign Het
Hsd3b2 A T 3: 98,711,663 L322Q probably damaging Het
Htra4 T C 8: 25,033,659 T297A probably damaging Het
Il22 C A 10: 118,205,153 R55S probably damaging Het
Ints1 G A 5: 139,771,876 T324M possibly damaging Het
Ints7 T C 1: 191,596,933 V268A probably damaging Het
Kctd20 G A 17: 28,966,792 V370I probably damaging Het
Lama1 T A 17: 67,716,775 M55K probably benign Het
Larp1 C A 11: 58,047,980 S494* probably null Het
Ldb3 A T 14: 34,555,513 H262Q possibly damaging Het
Lepr C A 4: 101,780,047 T711K possibly damaging Het
Mon2 T C 10: 123,016,517 I984V probably benign Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Oasl1 A G 5: 114,928,158 M112V probably benign Het
Olfr371 G T 8: 85,230,938 A148S probably benign Het
Olfr715b A T 7: 107,106,027 M278K probably benign Het
Olfr807 A T 10: 129,754,521 S310T probably benign Het
P2ry1 T A 3: 61,003,460 S7T probably benign Het
Pidd1 G T 7: 141,442,986 R98S possibly damaging Het
Pkd1l1 A C 11: 8,961,340 F312L unknown Het
Pla2r1 A T 2: 60,504,180 M416K possibly damaging Het
Pold1 T C 7: 44,541,901 E194G possibly damaging Het
Poldip2 T A 11: 78,513,987 Y77N probably damaging Het
Ppp2r3a G T 9: 101,211,980 N381K probably benign Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsu1 A G 2: 13,216,726 probably benign Het
Selenoi T A 5: 30,252,742 W90R probably damaging Het
Spata31 C A 13: 64,922,742 Y901* probably null Het
Ssrp1 T A 2: 85,045,722 Y607* probably null Het
Stk10 T A 11: 32,598,471 N346K probably benign Het
Surf1 G T 2: 26,916,346 probably benign Het
Synj2 A T 17: 6,033,888 E283V probably damaging Het
Tg G A 15: 66,758,006 probably null Het
Traf1 A T 2: 34,956,277 D42E probably benign Het
Ttn T C 2: 76,740,865 I26561M probably damaging Het
Ubp1 T C 9: 113,956,002 Y128H probably damaging Het
Vmn1r216 T A 13: 23,099,336 I63K probably benign Het
Vmn1r49 T A 6: 90,072,630 H130L probably benign Het
Vmn2r90 C T 17: 17,712,305 T158I probably damaging Het
Vps13d T C 4: 145,054,155 S885G probably damaging Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056254 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
R0107:Spag17 UTSW 3 100050787 missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1768:Spag17 UTSW 3 100027352 missense possibly damaging 0.53
R1782:Spag17 UTSW 3 100010754 missense probably benign 0.02
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2118:Spag17 UTSW 3 100049240 missense possibly damaging 0.72
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4756:Spag17 UTSW 3 100103385 missense possibly damaging 0.68
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5074:Spag17 UTSW 3 100080118 missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100101388 missense probably benign 0.16
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100095791 nonsense probably null
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6228:Spag17 UTSW 3 100022602 missense probably benign 0.33
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R6953:Spag17 UTSW 3 100034975 missense possibly damaging 0.53
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAAACAGTCAACAGGCCTGTGTC -3'
(R):5'- GGGGCAATACTGATGGACTC -3'

Sequencing Primer
(F):5'- TGTGTCCCAGCCAACTGC -3'
(R):5'- CAATACTGATGGACTCTGTGAGTTCC -3'
Posted On2016-02-04