Incidental Mutation 'R4797:Rnd2'
ID369155
Institutional Source Beutler Lab
Gene Symbol Rnd2
Ensembl Gene ENSMUSG00000001313
Gene NameRho family GTPase 2
SynonymsArhn, Rohn
MMRRC Submission 042421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4797 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101464999-101471853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101468999 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 57 (L57F)
Ref Sequence ENSEMBL: ENSMUSP00000001347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001347] [ENSMUST00000040430]
Predicted Effect probably damaging
Transcript: ENSMUST00000001347
AA Change: L57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001347
Gene: ENSMUSG00000001313
AA Change: L57F

DomainStartEndE-ValueType
RHO 10 184 5.22e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040430
SMART Domains Protein: ENSMUSP00000048350
Gene: ENSMUSG00000034993

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
Pfam:ADH_N 89 157 8.8e-11 PFAM
Pfam:ADH_zinc_N 213 355 2.1e-21 PFAM
Pfam:ADH_zinc_N_2 245 398 6.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153185
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase family, whose members play a key role in the regulation of actin cytoskeleton organization in response to extracellular growth factors. This particular family member has been implicated in the regulation of neuronal morphology and endosomal trafficking. The gene localizes to chromosome 17 and is the centromeric neighbor of the breast-ovarian cancer susceptibility gene BRCA1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,118,119 T1195A probably benign Het
Apobr G A 7: 126,587,584 E756K probably benign Het
Arpc3 A G 5: 122,404,152 E77G possibly damaging Het
Atp2b2 A T 6: 113,789,886 M464K possibly damaging Het
Atxn7l2 A G 3: 108,204,550 S379P probably damaging Het
Ccdc91 A T 6: 147,592,143 E344D unknown Het
Cdc42bpg G A 19: 6,320,447 R1190Q probably damaging Het
Cdh17 C A 4: 11,810,390 Q694K probably benign Het
Chordc1 G T 9: 18,292,376 probably benign Het
Copg1 A G 6: 87,903,468 probably benign Het
Dcbld1 T C 10: 52,284,127 V37A probably damaging Het
Ddb2 A G 2: 91,236,818 probably benign Het
Dok5 A T 2: 170,830,122 R115* probably null Het
Drc7 T C 8: 95,074,297 I649T probably damaging Het
E130309D02Rik A G 5: 143,311,749 F181S probably benign Het
Efr3a A G 15: 65,857,588 T713A probably damaging Het
Epg5 G A 18: 78,030,399 D2494N probably benign Het
Eps15 G A 4: 109,366,530 probably benign Het
Glb1l3 T C 9: 26,828,446 D356G probably damaging Het
Gm10639 A T 9: 78,304,397 Y147F probably benign Het
Gm1818 A T 12: 48,555,610 noncoding transcript Het
Gm4450 T A 3: 98,456,431 R62* probably null Het
Hcrtr2 C A 9: 76,254,534 M191I probably damaging Het
Heatr1 G A 13: 12,412,048 E685K probably benign Het
Hsd3b2 A T 3: 98,711,663 L322Q probably damaging Het
Htra4 T C 8: 25,033,659 T297A probably damaging Het
Il22 C A 10: 118,205,153 R55S probably damaging Het
Ints1 G A 5: 139,771,876 T324M possibly damaging Het
Ints7 T C 1: 191,596,933 V268A probably damaging Het
Kctd20 G A 17: 28,966,792 V370I probably damaging Het
Lama1 T A 17: 67,716,775 M55K probably benign Het
Larp1 C A 11: 58,047,980 S494* probably null Het
Ldb3 A T 14: 34,555,513 H262Q possibly damaging Het
Lepr C A 4: 101,780,047 T711K possibly damaging Het
Mon2 T C 10: 123,016,517 I984V probably benign Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Oasl1 A G 5: 114,928,158 M112V probably benign Het
Olfr371 G T 8: 85,230,938 A148S probably benign Het
Olfr715b A T 7: 107,106,027 M278K probably benign Het
Olfr807 A T 10: 129,754,521 S310T probably benign Het
P2ry1 T A 3: 61,003,460 S7T probably benign Het
Pidd1 G T 7: 141,442,986 R98S possibly damaging Het
Pkd1l1 A C 11: 8,961,340 F312L unknown Het
Pla2r1 A T 2: 60,504,180 M416K possibly damaging Het
Pold1 T C 7: 44,541,901 E194G possibly damaging Het
Poldip2 T A 11: 78,513,987 Y77N probably damaging Het
Ppp2r3a G T 9: 101,211,980 N381K probably benign Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Rsu1 A G 2: 13,216,726 probably benign Het
Selenoi T A 5: 30,252,742 W90R probably damaging Het
Spag17 T A 3: 99,984,479 D216E possibly damaging Het
Spata31 C A 13: 64,922,742 Y901* probably null Het
Ssrp1 T A 2: 85,045,722 Y607* probably null Het
Stk10 T A 11: 32,598,471 N346K probably benign Het
Surf1 G T 2: 26,916,346 probably benign Het
Synj2 A T 17: 6,033,888 E283V probably damaging Het
Tg G A 15: 66,758,006 probably null Het
Traf1 A T 2: 34,956,277 D42E probably benign Het
Ttn T C 2: 76,740,865 I26561M probably damaging Het
Ubp1 T C 9: 113,956,002 Y128H probably damaging Het
Vmn1r216 T A 13: 23,099,336 I63K probably benign Het
Vmn1r49 T A 6: 90,072,630 H130L probably benign Het
Vmn2r90 C T 17: 17,712,305 T158I probably damaging Het
Vps13d T C 4: 145,054,155 S885G probably damaging Het
Other mutations in Rnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Rnd2 APN 11 101471191 missense possibly damaging 0.81
IGL01964:Rnd2 APN 11 101470806 unclassified probably null
Atkins UTSW 11 101468999 missense probably damaging 1.00
R1581:Rnd2 UTSW 11 101471196 missense probably benign
R4606:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4824:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4825:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4931:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5005:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5078:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5079:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5402:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5405:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5497:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5498:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5501:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5534:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5619:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5666:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5669:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5670:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5671:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5786:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5788:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5844:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5845:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5857:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5989:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5991:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5992:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6018:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6019:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6020:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6122:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6144:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6148:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6208:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6209:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6226:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6230:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6332:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6333:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6335:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6491:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6541:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6605:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6606:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6607:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6677:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6678:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6726:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6796:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6797:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCTCAGACCAACTTCTGTC -3'
(R):5'- CCTACGTGGTTTCTGTCAGG -3'

Sequencing Primer
(F):5'- ACCAACTTCTGTCTAGGGACTGAG -3'
(R):5'- GGTTTCTGTCAGGCCTAAGAAACTC -3'
Posted On2016-02-04