Incidental Mutation 'R4797:Gm1818'
ID369157
Institutional Source Beutler Lab
Gene Symbol Gm1818
Ensembl Gene ENSMUSG00000091277
Gene Namepredicted gene 1818
SynonymsLOC217536
MMRRC Submission 042421-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R4797 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location48555059-48559896 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 48555610 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169406
SMART Domains Protein: ENSMUSP00000131939
Gene: ENSMUSG00000091277

DomainStartEndE-ValueType
low complexity region 1 22 N/A INTRINSIC
Pfam:RrnaAD 78 377 4.3e-23 PFAM
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (69/72)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,118,119 T1195A probably benign Het
Apobr G A 7: 126,587,584 E756K probably benign Het
Arpc3 A G 5: 122,404,152 E77G possibly damaging Het
Atp2b2 A T 6: 113,789,886 M464K possibly damaging Het
Atxn7l2 A G 3: 108,204,550 S379P probably damaging Het
Ccdc91 A T 6: 147,592,143 E344D unknown Het
Cdc42bpg G A 19: 6,320,447 R1190Q probably damaging Het
Cdh17 C A 4: 11,810,390 Q694K probably benign Het
Chordc1 G T 9: 18,292,376 probably benign Het
Copg1 A G 6: 87,903,468 probably benign Het
Dcbld1 T C 10: 52,284,127 V37A probably damaging Het
Ddb2 A G 2: 91,236,818 probably benign Het
Dok5 A T 2: 170,830,122 R115* probably null Het
Drc7 T C 8: 95,074,297 I649T probably damaging Het
E130309D02Rik A G 5: 143,311,749 F181S probably benign Het
Efr3a A G 15: 65,857,588 T713A probably damaging Het
Epg5 G A 18: 78,030,399 D2494N probably benign Het
Eps15 G A 4: 109,366,530 probably benign Het
Glb1l3 T C 9: 26,828,446 D356G probably damaging Het
Gm10639 A T 9: 78,304,397 Y147F probably benign Het
Gm4450 T A 3: 98,456,431 R62* probably null Het
Hcrtr2 C A 9: 76,254,534 M191I probably damaging Het
Heatr1 G A 13: 12,412,048 E685K probably benign Het
Hsd3b2 A T 3: 98,711,663 L322Q probably damaging Het
Htra4 T C 8: 25,033,659 T297A probably damaging Het
Il22 C A 10: 118,205,153 R55S probably damaging Het
Ints1 G A 5: 139,771,876 T324M possibly damaging Het
Ints7 T C 1: 191,596,933 V268A probably damaging Het
Kctd20 G A 17: 28,966,792 V370I probably damaging Het
Lama1 T A 17: 67,716,775 M55K probably benign Het
Larp1 C A 11: 58,047,980 S494* probably null Het
Ldb3 A T 14: 34,555,513 H262Q possibly damaging Het
Lepr C A 4: 101,780,047 T711K possibly damaging Het
Mon2 T C 10: 123,016,517 I984V probably benign Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Oasl1 A G 5: 114,928,158 M112V probably benign Het
Olfr371 G T 8: 85,230,938 A148S probably benign Het
Olfr715b A T 7: 107,106,027 M278K probably benign Het
Olfr807 A T 10: 129,754,521 S310T probably benign Het
P2ry1 T A 3: 61,003,460 S7T probably benign Het
Pidd1 G T 7: 141,442,986 R98S possibly damaging Het
Pkd1l1 A C 11: 8,961,340 F312L unknown Het
Pla2r1 A T 2: 60,504,180 M416K possibly damaging Het
Pold1 T C 7: 44,541,901 E194G possibly damaging Het
Poldip2 T A 11: 78,513,987 Y77N probably damaging Het
Ppp2r3a G T 9: 101,211,980 N381K probably benign Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsu1 A G 2: 13,216,726 probably benign Het
Selenoi T A 5: 30,252,742 W90R probably damaging Het
Spag17 T A 3: 99,984,479 D216E possibly damaging Het
Spata31 C A 13: 64,922,742 Y901* probably null Het
Ssrp1 T A 2: 85,045,722 Y607* probably null Het
Stk10 T A 11: 32,598,471 N346K probably benign Het
Surf1 G T 2: 26,916,346 probably benign Het
Synj2 A T 17: 6,033,888 E283V probably damaging Het
Tg G A 15: 66,758,006 probably null Het
Traf1 A T 2: 34,956,277 D42E probably benign Het
Ttn T C 2: 76,740,865 I26561M probably damaging Het
Ubp1 T C 9: 113,956,002 Y128H probably damaging Het
Vmn1r216 T A 13: 23,099,336 I63K probably benign Het
Vmn1r49 T A 6: 90,072,630 H130L probably benign Het
Vmn2r90 C T 17: 17,712,305 T158I probably damaging Het
Vps13d T C 4: 145,054,155 S885G probably damaging Het
Other mutations in Gm1818
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Gm1818 APN 12 48555800 exon noncoding transcript
IGL01472:Gm1818 APN 12 48556289 exon noncoding transcript
IGL01634:Gm1818 APN 12 48556209 exon noncoding transcript
IGL01874:Gm1818 APN 12 48556190 exon noncoding transcript
IGL02287:Gm1818 APN 12 48555722 exon noncoding transcript
IGL02805:Gm1818 APN 12 48555735 exon noncoding transcript
R1174:Gm1818 UTSW 12 48556199 exon noncoding transcript
R1175:Gm1818 UTSW 12 48556199 exon noncoding transcript
R1636:Gm1818 UTSW 12 48555767 exon noncoding transcript
R4828:Gm1818 UTSW 12 48555626 exon noncoding transcript
R4937:Gm1818 UTSW 12 48559824 exon noncoding transcript
R5022:Gm1818 UTSW 12 48555535 exon noncoding transcript
R5023:Gm1818 UTSW 12 48555535 exon noncoding transcript
R5952:Gm1818 UTSW 12 48555936 exon noncoding transcript
R6057:Gm1818 UTSW 12 48555563 exon noncoding transcript
R6131:Gm1818 UTSW 12 48555536 exon noncoding transcript
Z1088:Gm1818 UTSW 12 48556124 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GATACATTCTAGCAGCTGTGTCTCC -3'
(R):5'- TTCCGGAAACTGATAGCGACTC -3'

Sequencing Primer
(F):5'- AACCGTACTCAGTGAACG -3'
(R):5'- TGATAGCGACTCCTAAAAGACCGG -3'
Posted On2016-02-04