Incidental Mutation 'R4798:Ubap2l'
ID369189
Institutional Source Beutler Lab
Gene Symbol Ubap2l
Ensembl Gene ENSMUSG00000042520
Gene Nameubiquitin-associated protein 2-like
SynonymsA430103N23Rik, NICE-4, 3110083O19Rik, 4932431F02Rik
MMRRC Submission 042422-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4798 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90000140-90052628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90020903 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 553 (T553M)
Ref Sequence ENSEMBL: ENSMUSP00000142524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000090908] [ENSMUST00000195995] [ENSMUST00000196843] [ENSMUST00000198322] [ENSMUST00000199834]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029553
AA Change: T573M

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520
AA Change: T573M

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064639
AA Change: T578M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520
AA Change: T578M

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000090908
AA Change: T553M
SMART Domains Protein: ENSMUSP00000088424
Gene: ENSMUSG00000042520
AA Change: T553M

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195995
AA Change: T584M

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143638
Gene: ENSMUSG00000042520
AA Change: T584M

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 526 557 3.7e-18 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196747
Predicted Effect possibly damaging
Transcript: ENSMUST00000196843
AA Change: T573M

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520
AA Change: T573M

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196952
Predicted Effect unknown
Transcript: ENSMUST00000197177
AA Change: T74M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197633
Predicted Effect probably damaging
Transcript: ENSMUST00000198322
AA Change: T553M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520
AA Change: T553M

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199612
Predicted Effect possibly damaging
Transcript: ENSMUST00000199834
AA Change: T584M

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143254
Gene: ENSMUSG00000042520
AA Change: T584M

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200320
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (111/114)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased female body size and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,624,965 D617E probably benign Het
2210408I21Rik T C 13: 77,323,724 W1083R possibly damaging Het
Adamts10 T A 17: 33,528,752 L54Q probably damaging Het
Ankrd24 A C 10: 81,643,315 probably benign Het
Atg2b A G 12: 105,652,629 S813P probably benign Het
Atp13a3 T A 16: 30,341,240 I716F probably damaging Het
Atp6v1c1 T A 15: 38,689,176 W294R probably damaging Het
Atrnl1 G T 19: 58,042,361 A1312S probably benign Het
B230359F08Rik T A 14: 53,795,951 C106S probably damaging Het
Bcl2 A T 1: 106,712,608 H91Q possibly damaging Het
Cacna1c G A 6: 118,630,302 Q1214* probably null Het
Cacna1g C A 11: 94,433,847 G1183W probably damaging Het
Capsl A T 15: 9,461,742 M75L probably benign Het
Ccdc122 T G 14: 77,111,607 probably benign Het
Ccdc57 T G 11: 120,881,857 R645S possibly damaging Het
Cdh8 T A 8: 99,024,926 R720* probably null Het
Cenpx T G 11: 120,711,784 probably benign Het
Clic3 T C 2: 25,458,182 S114P probably damaging Het
Crtac1 A T 19: 42,323,801 W158R possibly damaging Het
Dhrs11 T A 11: 84,828,800 Q33L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpp9 G T 17: 56,191,016 Q647K probably damaging Het
Egf C T 3: 129,716,678 G64D probably damaging Het
Eif2b4 C T 5: 31,189,520 probably benign Het
Epas1 A G 17: 86,805,839 N151S probably benign Het
Fastkd1 A T 2: 69,691,307 I707K probably benign Het
Fbln2 A G 6: 91,269,186 T1005A probably benign Het
Fgfrl1 T A 5: 108,703,497 Y93* probably null Het
Fktn A G 4: 53,744,637 T306A probably benign Het
Gabbr2 T G 4: 46,991,139 Y96S possibly damaging Het
Gm16332 A T 1: 139,891,658 noncoding transcript Het
Gm5145 G T 17: 20,570,548 V63F probably damaging Het
Gm9970 G T 5: 31,241,085 probably benign Het
Gpr158 A G 2: 21,783,182 T545A probably damaging Het
Heatr1 G A 13: 12,412,048 E685K probably benign Het
Herc6 A T 6: 57,604,166 I284F probably damaging Het
Hook1 C G 4: 96,002,557 A301G possibly damaging Het
Hpcal4 T A 4: 123,190,698 M140K possibly damaging Het
Il11ra1 T C 4: 41,766,096 probably benign Het
Ildr1 A T 16: 36,722,555 H439L possibly damaging Het
Itga11 A G 9: 62,776,727 probably null Het
Jag2 A T 12: 112,916,632 D337E probably benign Het
Krt82 C T 15: 101,550,488 R39Q probably benign Het
L3mbtl4 T A 17: 68,359,480 M1K probably null Het
Lrrc32 T G 7: 98,499,017 F335V probably damaging Het
Lurap1l T A 4: 80,911,413 V20E probably damaging Het
Lyar T A 5: 38,227,886 V90D possibly damaging Het
Man2c1 C T 9: 57,141,185 R778* probably null Het
Mapk6 A G 9: 75,388,432 F595L probably benign Het
Mccc1 A G 3: 35,985,001 I281T probably damaging Het
Mep1b T C 18: 21,093,254 V391A probably damaging Het
Mier1 G A 4: 103,130,998 D40N probably damaging Het
Mkx T C 18: 7,002,432 H38R probably benign Het
Mroh4 A G 15: 74,626,179 L184P probably damaging Het
Muc2 C A 7: 141,754,140 N834K probably benign Het
Mycl A G 4: 123,000,256 D283G probably damaging Het
Myh6 T C 14: 54,953,293 N975S probably damaging Het
Myl12a A G 17: 70,996,302 probably benign Het
Mysm1 T C 4: 94,965,673 T230A probably benign Het
Naca A G 10: 128,047,803 K2099R probably null Het
Nbeal1 T G 1: 60,222,193 probably null Het
Nedd1 A G 10: 92,698,910 V246A probably benign Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Ninl G A 2: 150,959,881 R156* probably null Het
Obscn T A 11: 59,069,859 I3418F probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Pappa2 T C 1: 158,857,379 N730S probably damaging Het
Pcm1 G A 8: 41,293,678 D1305N probably damaging Het
Pcsk4 A T 10: 80,323,104 I485N probably damaging Het
Phldb2 T C 16: 45,825,874 R111G probably damaging Het
Prdm10 T C 9: 31,341,273 F385S probably damaging Het
Prkcsh C T 9: 22,011,738 P351L probably damaging Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Rad51c T C 11: 87,395,378 D251G probably damaging Het
Radil A G 5: 142,485,163 F1088L probably benign Het
Rere C A 4: 150,615,167 probably benign Het
Rnf167 T A 11: 70,650,135 C196S probably benign Het
Robo2 T A 16: 74,352,745 Y65F probably damaging Het
Scarf2 G A 16: 17,803,507 C319Y probably damaging Het
Sec24c A G 14: 20,693,712 D995G probably damaging Het
Selenbp1 T C 3: 94,943,900 L369S probably benign Het
Sgpl1 A T 10: 61,123,344 I53K possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc1a6 A T 10: 78,800,118 Y339F probably damaging Het
Smchd1 G T 17: 71,360,053 Y1781* probably null Het
Smg1 T C 7: 118,180,474 S1233G probably benign Het
Snap91 A T 9: 86,783,454 probably benign Het
Snx29 T A 16: 11,420,736 L112Q probably damaging Het
Sptbn5 T C 2: 120,059,141 probably benign Het
Srl A T 16: 4,492,358 H502Q possibly damaging Het
St5 C T 7: 109,557,033 G170D probably damaging Het
St8sia3 A G 18: 64,271,749 M366V probably benign Het
Stk19 A T 17: 34,822,509 probably benign Het
Syngap1 G A 17: 26,961,449 A611T probably benign Het
Tas2r113 A G 6: 132,893,707 T233A possibly damaging Het
Tbcc G A 17: 46,891,219 W177* probably null Het
Tcstv3 T A 13: 120,318,082 probably null Het
Trmt61a G A 12: 111,678,713 V28M possibly damaging Het
Urb1 T C 16: 90,757,827 N1839S probably benign Het
Ush2a T C 1: 188,743,545 L2893P probably damaging Het
Usp24 G A 4: 106,360,162 V421M possibly damaging Het
Vmn1r43 T C 6: 89,869,910 E198G probably benign Het
Vps13d A C 4: 145,178,056 S130A probably damaging Het
Zfp426 T A 9: 20,471,014 I211F probably benign Het
Znfx1 T C 2: 167,038,569 probably null Het
Other mutations in Ubap2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2l APN 3 90009256 nonsense probably null
IGL02606:Ubap2l APN 3 90038428 missense probably damaging 0.98
IGL02809:Ubap2l APN 3 90021246 missense probably damaging 1.00
panhandle UTSW 3 90031376 splice site probably benign
R0052:Ubap2l UTSW 3 90038928 missense possibly damaging 0.93
R0052:Ubap2l UTSW 3 90038928 missense possibly damaging 0.93
R0128:Ubap2l UTSW 3 90021373 missense possibly damaging 0.89
R0130:Ubap2l UTSW 3 90021373 missense possibly damaging 0.89
R0502:Ubap2l UTSW 3 90009213 missense probably damaging 1.00
R0619:Ubap2l UTSW 3 90017220 missense probably benign 0.01
R0726:Ubap2l UTSW 3 90021246 missense probably damaging 1.00
R1023:Ubap2l UTSW 3 90047873 utr 5 prime probably benign
R1172:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1174:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1175:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1191:Ubap2l UTSW 3 90023575 missense probably damaging 1.00
R1432:Ubap2l UTSW 3 90019328 missense probably benign 0.11
R1582:Ubap2l UTSW 3 90034671 missense probably damaging 1.00
R1771:Ubap2l UTSW 3 90019231 missense probably damaging 1.00
R2058:Ubap2l UTSW 3 90031376 splice site probably benign
R2059:Ubap2l UTSW 3 90031376 splice site probably benign
R2081:Ubap2l UTSW 3 90038964 missense possibly damaging 0.92
R2408:Ubap2l UTSW 3 90009132 missense probably null 0.99
R3404:Ubap2l UTSW 3 90038850 missense probably damaging 1.00
R3551:Ubap2l UTSW 3 90015451 missense unknown
R4132:Ubap2l UTSW 3 90009184 missense probably damaging 1.00
R4782:Ubap2l UTSW 3 90020903 missense probably damaging 0.98
R5173:Ubap2l UTSW 3 90021030 missense possibly damaging 0.86
R5274:Ubap2l UTSW 3 90012730 missense probably damaging 1.00
R5387:Ubap2l UTSW 3 90006596 missense probably benign 0.10
R6548:Ubap2l UTSW 3 90023560 missense probably damaging 1.00
R6912:Ubap2l UTSW 3 90038848 missense possibly damaging 0.84
R6995:Ubap2l UTSW 3 90009241 missense probably damaging 0.98
R7039:Ubap2l UTSW 3 90002355 missense probably damaging 1.00
R7323:Ubap2l UTSW 3 90015406 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCAAGGTACCGTCAGAATCAAAC -3'
(R):5'- TCATAGATTCCTGCTCTGGCTG -3'

Sequencing Primer
(F):5'- CCAAATTGGTCTAGTGAGCTCCAG -3'
(R):5'- CTGTGGAGATGCCTGGCTCAG -3'
Posted On2016-02-04