Incidental Mutation 'R4798:Usp24'
ID369199
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Nameubiquitin specific peptidase 24
Synonyms2810030C21Rik, 2700066K03Rik
MMRRC Submission 042422-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4798 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location106316213-106441322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106360162 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 421 (V421M)
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094933
AA Change: V420M

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: V420M

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106798
SMART Domains Protein: ENSMUSP00000102410
Gene: ENSMUSG00000028514

DomainStartEndE-ValueType
SCOP:d1ifya_ 3 47 2e-6 SMART
Blast:UBA 5 43 2e-17 BLAST
low complexity region 57 96 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165709
AA Change: V421M

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: V421M

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Meta Mutation Damage Score 0.326 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (111/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,624,965 D617E probably benign Het
2210408I21Rik T C 13: 77,323,724 W1083R possibly damaging Het
Adamts10 T A 17: 33,528,752 L54Q probably damaging Het
Ankrd24 A C 10: 81,643,315 probably benign Het
Atg2b A G 12: 105,652,629 S813P probably benign Het
Atp13a3 T A 16: 30,341,240 I716F probably damaging Het
Atp6v1c1 T A 15: 38,689,176 W294R probably damaging Het
Atrnl1 G T 19: 58,042,361 A1312S probably benign Het
B230359F08Rik T A 14: 53,795,951 C106S probably damaging Het
Bcl2 A T 1: 106,712,608 H91Q possibly damaging Het
Cacna1c G A 6: 118,630,302 Q1214* probably null Het
Cacna1g C A 11: 94,433,847 G1183W probably damaging Het
Capsl A T 15: 9,461,742 M75L probably benign Het
Ccdc122 T G 14: 77,111,607 probably benign Het
Ccdc57 T G 11: 120,881,857 R645S possibly damaging Het
Cdh8 T A 8: 99,024,926 R720* probably null Het
Cenpx T G 11: 120,711,784 probably benign Het
Clic3 T C 2: 25,458,182 S114P probably damaging Het
Crtac1 A T 19: 42,323,801 W158R possibly damaging Het
Dhrs11 T A 11: 84,828,800 Q33L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpp9 G T 17: 56,191,016 Q647K probably damaging Het
Egf C T 3: 129,716,678 G64D probably damaging Het
Eif2b4 C T 5: 31,189,520 probably benign Het
Epas1 A G 17: 86,805,839 N151S probably benign Het
Fastkd1 A T 2: 69,691,307 I707K probably benign Het
Fbln2 A G 6: 91,269,186 T1005A probably benign Het
Fgfrl1 T A 5: 108,703,497 Y93* probably null Het
Fktn A G 4: 53,744,637 T306A probably benign Het
Gabbr2 T G 4: 46,991,139 Y96S possibly damaging Het
Gm16332 A T 1: 139,891,658 noncoding transcript Het
Gm5145 G T 17: 20,570,548 V63F probably damaging Het
Gm9970 G T 5: 31,241,085 probably benign Het
Gpr158 A G 2: 21,783,182 T545A probably damaging Het
Heatr1 G A 13: 12,412,048 E685K probably benign Het
Herc6 A T 6: 57,604,166 I284F probably damaging Het
Hook1 C G 4: 96,002,557 A301G possibly damaging Het
Hpcal4 T A 4: 123,190,698 M140K possibly damaging Het
Il11ra1 T C 4: 41,766,096 probably benign Het
Ildr1 A T 16: 36,722,555 H439L possibly damaging Het
Itga11 A G 9: 62,776,727 probably null Het
Jag2 A T 12: 112,916,632 D337E probably benign Het
Krt82 C T 15: 101,550,488 R39Q probably benign Het
L3mbtl4 T A 17: 68,359,480 M1K probably null Het
Lrrc32 T G 7: 98,499,017 F335V probably damaging Het
Lurap1l T A 4: 80,911,413 V20E probably damaging Het
Lyar T A 5: 38,227,886 V90D possibly damaging Het
Man2c1 C T 9: 57,141,185 R778* probably null Het
Mapk6 A G 9: 75,388,432 F595L probably benign Het
Mccc1 A G 3: 35,985,001 I281T probably damaging Het
Mep1b T C 18: 21,093,254 V391A probably damaging Het
Mier1 G A 4: 103,130,998 D40N probably damaging Het
Mkx T C 18: 7,002,432 H38R probably benign Het
Mroh4 A G 15: 74,626,179 L184P probably damaging Het
Muc2 C A 7: 141,754,140 N834K probably benign Het
Mycl A G 4: 123,000,256 D283G probably damaging Het
Myh6 T C 14: 54,953,293 N975S probably damaging Het
Myl12a A G 17: 70,996,302 probably benign Het
Mysm1 T C 4: 94,965,673 T230A probably benign Het
Naca A G 10: 128,047,803 K2099R probably null Het
Nbeal1 T G 1: 60,222,193 probably null Het
Nedd1 A G 10: 92,698,910 V246A probably benign Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Ninl G A 2: 150,959,881 R156* probably null Het
Obscn T A 11: 59,069,859 I3418F probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Pappa2 T C 1: 158,857,379 N730S probably damaging Het
Pcm1 G A 8: 41,293,678 D1305N probably damaging Het
Pcsk4 A T 10: 80,323,104 I485N probably damaging Het
Phldb2 T C 16: 45,825,874 R111G probably damaging Het
Prdm10 T C 9: 31,341,273 F385S probably damaging Het
Prkcsh C T 9: 22,011,738 P351L probably damaging Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Rad51c T C 11: 87,395,378 D251G probably damaging Het
Radil A G 5: 142,485,163 F1088L probably benign Het
Rere C A 4: 150,615,167 probably benign Het
Rnf167 T A 11: 70,650,135 C196S probably benign Het
Robo2 T A 16: 74,352,745 Y65F probably damaging Het
Scarf2 G A 16: 17,803,507 C319Y probably damaging Het
Sec24c A G 14: 20,693,712 D995G probably damaging Het
Selenbp1 T C 3: 94,943,900 L369S probably benign Het
Sgpl1 A T 10: 61,123,344 I53K possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc1a6 A T 10: 78,800,118 Y339F probably damaging Het
Smchd1 G T 17: 71,360,053 Y1781* probably null Het
Smg1 T C 7: 118,180,474 S1233G probably benign Het
Snap91 A T 9: 86,783,454 probably benign Het
Snx29 T A 16: 11,420,736 L112Q probably damaging Het
Sptbn5 T C 2: 120,059,141 probably benign Het
Srl A T 16: 4,492,358 H502Q possibly damaging Het
St5 C T 7: 109,557,033 G170D probably damaging Het
St8sia3 A G 18: 64,271,749 M366V probably benign Het
Stk19 A T 17: 34,822,509 probably benign Het
Syngap1 G A 17: 26,961,449 A611T probably benign Het
Tas2r113 A G 6: 132,893,707 T233A possibly damaging Het
Tbcc G A 17: 46,891,219 W177* probably null Het
Tcstv3 T A 13: 120,318,082 probably null Het
Trmt61a G A 12: 111,678,713 V28M possibly damaging Het
Ubap2l G A 3: 90,020,903 T553M probably damaging Het
Urb1 T C 16: 90,757,827 N1839S probably benign Het
Ush2a T C 1: 188,743,545 L2893P probably damaging Het
Vmn1r43 T C 6: 89,869,910 E198G probably benign Het
Vps13d A C 4: 145,178,056 S130A probably damaging Het
Zfp426 T A 9: 20,471,014 I211F probably benign Het
Znfx1 T C 2: 167,038,569 probably null Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106359091 missense probably benign
IGL00340:Usp24 APN 4 106401139 missense probably damaging 0.99
IGL00480:Usp24 APN 4 106368106 missense probably damaging 0.99
IGL00548:Usp24 APN 4 106341298 missense probably damaging 0.96
IGL00655:Usp24 APN 4 106390318 missense probably damaging 0.99
IGL00674:Usp24 APN 4 106372679 splice site probably benign
IGL00718:Usp24 APN 4 106409704 missense probably benign 0.10
IGL00803:Usp24 APN 4 106385526 splice site probably benign
IGL01161:Usp24 APN 4 106436844 missense probably benign 0.02
IGL01344:Usp24 APN 4 106379385 missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106380099 missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106362232 missense probably benign 0.01
IGL01736:Usp24 APN 4 106423461 missense probably benign 0.00
IGL01737:Usp24 APN 4 106387734 missense probably benign 0.03
IGL01862:Usp24 APN 4 106408898 splice site probably benign
IGL01981:Usp24 APN 4 106375768 splice site probably benign
IGL02090:Usp24 APN 4 106411426 missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106387493 missense probably damaging 1.00
IGL02352:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02359:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02391:Usp24 APN 4 106407129 missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106436360 missense probably benign 0.07
IGL02537:Usp24 APN 4 106392367 missense probably damaging 1.00
IGL02638:Usp24 APN 4 106438770 splice site probably benign
IGL02638:Usp24 APN 4 106438772 splice site probably benign
IGL02830:Usp24 APN 4 106347387 missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106392402 missense probably benign 0.09
IGL03280:Usp24 APN 4 106380430 missense probably damaging 1.00
IGL03350:Usp24 APN 4 106371079 nonsense probably null
IGL03098:Usp24 UTSW 4 106371033 missense probably benign 0.11
R0035:Usp24 UTSW 4 106368027 missense probably benign 0.18
R0044:Usp24 UTSW 4 106412084 splice site probably benign
R0086:Usp24 UTSW 4 106392360 missense probably damaging 0.98
R0125:Usp24 UTSW 4 106397299 missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106407133 missense probably damaging 1.00
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0491:Usp24 UTSW 4 106402105 missense probably benign 0.41
R0687:Usp24 UTSW 4 106420504 missense probably damaging 1.00
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0973:Usp24 UTSW 4 106413678 splice site probably null
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106413678 splice site probably null
R1163:Usp24 UTSW 4 106420960 missense probably benign
R1293:Usp24 UTSW 4 106423553 missense probably benign 0.19
R1333:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106361933 missense probably damaging 1.00
R1699:Usp24 UTSW 4 106438827 missense probably damaging 0.99
R1728:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106377559 missense probably benign 0.04
R1917:Usp24 UTSW 4 106410286 missense probably damaging 1.00
R2045:Usp24 UTSW 4 106400980 missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106399113 critical splice donor site probably null
R2436:Usp24 UTSW 4 106409645 nonsense probably null
R2513:Usp24 UTSW 4 106379405 splice site probably null
R3824:Usp24 UTSW 4 106379066 missense probably benign
R3831:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3833:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3982:Usp24 UTSW 4 106387883 missense probably benign 0.38
R4022:Usp24 UTSW 4 106379224 splice site probably benign
R4067:Usp24 UTSW 4 106359089 missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106316773 missense probably benign 0.00
R4766:Usp24 UTSW 4 106416048 missense probably damaging 1.00
R4771:Usp24 UTSW 4 106362180 synonymous probably null
R4809:Usp24 UTSW 4 106413676 critical splice donor site probably null
R4822:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R4906:Usp24 UTSW 4 106388637 missense probably benign 0.20
R4934:Usp24 UTSW 4 106426546 missense probably benign 0.29
R5074:Usp24 UTSW 4 106420447 missense probably benign 0.12
R5151:Usp24 UTSW 4 106399112 critical splice donor site probably null
R5220:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106385424 missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106341214 missense probably benign 0.18
R5285:Usp24 UTSW 4 106407033 missense probably benign 0.00
R5292:Usp24 UTSW 4 106418263 missense probably benign 0.06
R5294:Usp24 UTSW 4 106362357 missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106408013 missense probably damaging 1.00
R5517:Usp24 UTSW 4 106375674 missense probably benign 0.02
R5522:Usp24 UTSW 4 106372721 missense probably damaging 1.00
R5546:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R5756:Usp24 UTSW 4 106362483 missense probably damaging 1.00
R5910:Usp24 UTSW 4 106380468 missense probably damaging 0.99
R5972:Usp24 UTSW 4 106368067 missense probably damaging 0.98
R6285:Usp24 UTSW 4 106374100 intron probably null
R6370:Usp24 UTSW 4 106380521 missense probably null 0.20
R6630:Usp24 UTSW 4 106387835 missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106360420 missense probably damaging 1.00
R7027:Usp24 UTSW 4 106362244 missense probably benign 0.21
R7088:Usp24 UTSW 4 106387546 missense probably damaging 1.00
R7129:Usp24 UTSW 4 106362215 missense probably damaging 1.00
R7131:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R7156:Usp24 UTSW 4 106387919 critical splice donor site probably null
X0024:Usp24 UTSW 4 106360446 missense probably benign 0.09
X0028:Usp24 UTSW 4 106368055 missense probably benign 0.01
X0066:Usp24 UTSW 4 106355731 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGTCACTAAGCTAGCCACAGG -3'
(R):5'- CAGATGCAGTGAATAACAACTCTAC -3'

Sequencing Primer
(F):5'- CTAGCCACAGGTAGCCTAAGG -3'
(R):5'- GCAGTGAATAACAACTCTACTAATGC -3'
Posted On2016-02-04