Incidental Mutation 'R0419:2210010C04Rik'
ID36921
Institutional Source Beutler Lab
Gene Symbol 2210010C04Rik
Ensembl Gene ENSMUSG00000029882
Gene NameRIKEN cDNA 2210010C04 gene
Synonyms
MMRRC Submission 038621-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0419 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41030268-41035509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41034347 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 34 (N34D)
Ref Sequence ENSEMBL: ENSMUSP00000031931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031931]
Predicted Effect probably benign
Transcript: ENSMUST00000031931
AA Change: N34D

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000031931
Gene: ENSMUSG00000029882
AA Change: N34D

DomainStartEndE-ValueType
Tryp_SPc 24 240 3.52e-102 SMART
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,842 probably benign Het
5730507C01Rik A T 12: 18,533,423 R161S possibly damaging Het
Adamts5 T C 16: 85,866,642 I735V probably benign Het
Arid1a G T 4: 133,681,124 P2024Q unknown Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
B3galt4 T C 17: 33,950,790 Y158C probably damaging Het
BC049715 A G 6: 136,840,145 T128A possibly damaging Het
Btaf1 T A 19: 36,945,229 I11N probably damaging Het
Cfb T C 17: 34,858,509 I496V probably damaging Het
Chd8 A T 14: 52,204,060 H858Q probably benign Het
Chrne T C 11: 70,615,723 I324V probably benign Het
Clec14a T C 12: 58,267,665 I390M probably damaging Het
Cpsf3 A G 12: 21,297,799 Y207C probably damaging Het
Cubn A C 2: 13,469,763 I410S possibly damaging Het
Cubn T A 2: 13,469,764 I410F possibly damaging Het
Dlc1 T C 8: 36,583,586 E997G possibly damaging Het
Emilin1 G T 5: 30,915,022 V71F probably damaging Het
Esrp2 T C 8: 106,134,675 E164G probably damaging Het
Fars2 A G 13: 36,537,311 T410A probably benign Het
Fat3 A G 9: 15,992,256 V2981A probably damaging Het
Fkbp15 G A 4: 62,326,136 T472I probably benign Het
Gm6871 A G 7: 41,573,445 V73A probably benign Het
Gnl2 T G 4: 125,053,527 S647R probably benign Het
Grb10 T C 11: 11,934,207 I500V possibly damaging Het
Herc1 T C 9: 66,446,074 probably benign Het
Iqgap2 A C 13: 95,689,699 probably null Het
Kcnu1 A T 8: 25,937,618 N321I probably benign Het
Kif23 G A 9: 61,926,405 R519* probably null Het
Klhl1 C T 14: 96,381,789 R224Q probably benign Het
Lama1 T C 17: 67,791,610 probably null Het
Lamp3 T C 16: 19,673,552 Y314C probably damaging Het
Lamtor5 C A 3: 107,281,911 R88S probably damaging Het
Nbea G T 3: 55,819,294 A2088E probably benign Het
Neo1 A G 9: 58,990,180 probably benign Het
Ntn4 A T 10: 93,682,429 R199S probably benign Het
Olfr1020 A T 2: 85,849,967 R172* probably null Het
Plekho2 A G 9: 65,557,052 S172P possibly damaging Het
Pmp2 T C 3: 10,180,763 Y129C probably damaging Het
Ralgapa2 A T 2: 146,428,672 M578K possibly damaging Het
Ranbp3 C T 17: 56,708,219 T307M possibly damaging Het
Serpinb11 G A 1: 107,376,860 W185* probably null Het
Setdb2 A T 14: 59,406,744 probably null Het
Sirpb1b A T 3: 15,548,596 V75E probably damaging Het
Slc13a1 A T 6: 24,100,293 L397Q probably damaging Het
Slc19a1 T A 10: 77,042,908 I355N probably damaging Het
Slc51a T A 16: 32,476,436 I275F possibly damaging Het
Spink14 T C 18: 44,031,867 S84P probably damaging Het
Stx2 A G 5: 128,993,577 probably benign Het
Tgfbi G T 13: 56,632,193 probably benign Het
Tshr T A 12: 91,537,869 M527K probably damaging Het
Upb1 T C 10: 75,412,883 V79A probably damaging Het
Zdhhc5 A T 2: 84,691,243 probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp280d T C 9: 72,312,237 V32A probably benign Het
Other mutations in 2210010C04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:2210010C04Rik APN 6 41031673 missense probably damaging 1.00
IGL01625:2210010C04Rik APN 6 41032948 missense probably benign 0.01
IGL02159:2210010C04Rik APN 6 41032957 missense probably benign 0.34
IGL03161:2210010C04Rik APN 6 41034306 missense probably damaging 0.96
R1715:2210010C04Rik UTSW 6 41032936 splice site probably null
R2057:2210010C04Rik UTSW 6 41032381 missense probably benign 0.06
R2059:2210010C04Rik UTSW 6 41032381 missense probably benign 0.06
R2136:2210010C04Rik UTSW 6 41035462 missense probably benign 0.28
R2446:2210010C04Rik UTSW 6 41031648 missense probably benign 0.15
R4862:2210010C04Rik UTSW 6 41032411 missense possibly damaging 0.74
R5068:2210010C04Rik UTSW 6 41032436 missense probably benign 0.35
R5369:2210010C04Rik UTSW 6 41033006 missense probably benign 0.00
R6392:2210010C04Rik UTSW 6 41032372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGATGGTTCCCTTCTGGGTCTTTAC -3'
(R):5'- ACAACTTATCGCCTGCCAAGATTAACG -3'

Sequencing Primer
(F):5'- accatttttttgcttagaatcaaacc -3'
(R):5'- TGCCAAGATTAACGCAAAGCTATC -3'
Posted On2013-05-09