Incidental Mutation 'R4798:St5'
ID369215
Institutional Source Beutler Lab
Gene Symbol St5
Ensembl Gene ENSMUSG00000031024
Gene Namesuppression of tumorigenicity 5
Synonyms2610305K15Rik, 2010004M01Rik
MMRRC Submission 042422-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R4798 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location109523911-109703605 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109557033 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 170 (G170D)
Ref Sequence ENSEMBL: ENSMUSP00000078264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005] [ENSMUST00000207394] [ENSMUST00000207745] [ENSMUST00000208583]
Predicted Effect probably damaging
Transcript: ENSMUST00000077909
AA Change: G170D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: G170D

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079282
AA Change: G170D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: G170D

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084738
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168005
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207394
Predicted Effect probably benign
Transcript: ENSMUST00000207745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208557
Predicted Effect probably benign
Transcript: ENSMUST00000208583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208981
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (111/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,624,965 D617E probably benign Het
2210408I21Rik T C 13: 77,323,724 W1083R possibly damaging Het
Adamts10 T A 17: 33,528,752 L54Q probably damaging Het
Ankrd24 A C 10: 81,643,315 probably benign Het
Atg2b A G 12: 105,652,629 S813P probably benign Het
Atp13a3 T A 16: 30,341,240 I716F probably damaging Het
Atp6v1c1 T A 15: 38,689,176 W294R probably damaging Het
Atrnl1 G T 19: 58,042,361 A1312S probably benign Het
B230359F08Rik T A 14: 53,795,951 C106S probably damaging Het
Bcl2 A T 1: 106,712,608 H91Q possibly damaging Het
Cacna1c G A 6: 118,630,302 Q1214* probably null Het
Cacna1g C A 11: 94,433,847 G1183W probably damaging Het
Capsl A T 15: 9,461,742 M75L probably benign Het
Ccdc122 T G 14: 77,111,607 probably benign Het
Ccdc57 T G 11: 120,881,857 R645S possibly damaging Het
Cdh8 T A 8: 99,024,926 R720* probably null Het
Cenpx T G 11: 120,711,784 probably benign Het
Clic3 T C 2: 25,458,182 S114P probably damaging Het
Crtac1 A T 19: 42,323,801 W158R possibly damaging Het
Dhrs11 T A 11: 84,828,800 Q33L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpp9 G T 17: 56,191,016 Q647K probably damaging Het
Egf C T 3: 129,716,678 G64D probably damaging Het
Eif2b4 C T 5: 31,189,520 probably benign Het
Epas1 A G 17: 86,805,839 N151S probably benign Het
Fastkd1 A T 2: 69,691,307 I707K probably benign Het
Fbln2 A G 6: 91,269,186 T1005A probably benign Het
Fgfrl1 T A 5: 108,703,497 Y93* probably null Het
Fktn A G 4: 53,744,637 T306A probably benign Het
Gabbr2 T G 4: 46,991,139 Y96S possibly damaging Het
Gm16332 A T 1: 139,891,658 noncoding transcript Het
Gm5145 G T 17: 20,570,548 V63F probably damaging Het
Gm9970 G T 5: 31,241,085 probably benign Het
Gpr158 A G 2: 21,783,182 T545A probably damaging Het
Heatr1 G A 13: 12,412,048 E685K probably benign Het
Herc6 A T 6: 57,604,166 I284F probably damaging Het
Hook1 C G 4: 96,002,557 A301G possibly damaging Het
Hpcal4 T A 4: 123,190,698 M140K possibly damaging Het
Il11ra1 T C 4: 41,766,096 probably benign Het
Ildr1 A T 16: 36,722,555 H439L possibly damaging Het
Itga11 A G 9: 62,776,727 probably null Het
Jag2 A T 12: 112,916,632 D337E probably benign Het
Krt82 C T 15: 101,550,488 R39Q probably benign Het
L3mbtl4 T A 17: 68,359,480 M1K probably null Het
Lrrc32 T G 7: 98,499,017 F335V probably damaging Het
Lurap1l T A 4: 80,911,413 V20E probably damaging Het
Lyar T A 5: 38,227,886 V90D possibly damaging Het
Man2c1 C T 9: 57,141,185 R778* probably null Het
Mapk6 A G 9: 75,388,432 F595L probably benign Het
Mccc1 A G 3: 35,985,001 I281T probably damaging Het
Mep1b T C 18: 21,093,254 V391A probably damaging Het
Mier1 G A 4: 103,130,998 D40N probably damaging Het
Mkx T C 18: 7,002,432 H38R probably benign Het
Mroh4 A G 15: 74,626,179 L184P probably damaging Het
Muc2 C A 7: 141,754,140 N834K probably benign Het
Mycl A G 4: 123,000,256 D283G probably damaging Het
Myh6 T C 14: 54,953,293 N975S probably damaging Het
Myl12a A G 17: 70,996,302 probably benign Het
Mysm1 T C 4: 94,965,673 T230A probably benign Het
Naca A G 10: 128,047,803 K2099R probably null Het
Nbeal1 T G 1: 60,222,193 probably null Het
Nedd1 A G 10: 92,698,910 V246A probably benign Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Ninl G A 2: 150,959,881 R156* probably null Het
Obscn T A 11: 59,069,859 I3418F probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Pappa2 T C 1: 158,857,379 N730S probably damaging Het
Pcm1 G A 8: 41,293,678 D1305N probably damaging Het
Pcsk4 A T 10: 80,323,104 I485N probably damaging Het
Phldb2 T C 16: 45,825,874 R111G probably damaging Het
Prdm10 T C 9: 31,341,273 F385S probably damaging Het
Prkcsh C T 9: 22,011,738 P351L probably damaging Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Rad51c T C 11: 87,395,378 D251G probably damaging Het
Radil A G 5: 142,485,163 F1088L probably benign Het
Rere C A 4: 150,615,167 probably benign Het
Rnf167 T A 11: 70,650,135 C196S probably benign Het
Robo2 T A 16: 74,352,745 Y65F probably damaging Het
Scarf2 G A 16: 17,803,507 C319Y probably damaging Het
Sec24c A G 14: 20,693,712 D995G probably damaging Het
Selenbp1 T C 3: 94,943,900 L369S probably benign Het
Sgpl1 A T 10: 61,123,344 I53K possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc1a6 A T 10: 78,800,118 Y339F probably damaging Het
Smchd1 G T 17: 71,360,053 Y1781* probably null Het
Smg1 T C 7: 118,180,474 S1233G probably benign Het
Snap91 A T 9: 86,783,454 probably benign Het
Snx29 T A 16: 11,420,736 L112Q probably damaging Het
Sptbn5 T C 2: 120,059,141 probably benign Het
Srl A T 16: 4,492,358 H502Q possibly damaging Het
St8sia3 A G 18: 64,271,749 M366V probably benign Het
Stk19 A T 17: 34,822,509 probably benign Het
Syngap1 G A 17: 26,961,449 A611T probably benign Het
Tas2r113 A G 6: 132,893,707 T233A possibly damaging Het
Tbcc G A 17: 46,891,219 W177* probably null Het
Tcstv3 T A 13: 120,318,082 probably null Het
Trmt61a G A 12: 111,678,713 V28M possibly damaging Het
Ubap2l G A 3: 90,020,903 T553M probably damaging Het
Urb1 T C 16: 90,757,827 N1839S probably benign Het
Ush2a T C 1: 188,743,545 L2893P probably damaging Het
Usp24 G A 4: 106,360,162 V421M possibly damaging Het
Vmn1r43 T C 6: 89,869,910 E198G probably benign Het
Vps13d A C 4: 145,178,056 S130A probably damaging Het
Zfp426 T A 9: 20,471,014 I211F probably benign Het
Znfx1 T C 2: 167,038,569 probably null Het
Other mutations in St5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:St5 APN 7 109527708 missense possibly damaging 0.71
IGL01132:St5 APN 7 109570005 unclassified probably null
IGL01288:St5 APN 7 109539822 missense probably damaging 0.96
IGL01645:St5 APN 7 109527634 nonsense probably null
IGL01714:St5 APN 7 109570062 missense probably damaging 0.99
IGL02021:St5 APN 7 109557372 missense probably damaging 1.00
IGL02302:St5 APN 7 109525331 missense probably damaging 1.00
IGL02496:St5 APN 7 109556235 missense possibly damaging 0.83
IGL02795:St5 APN 7 109556364 missense probably damaging 1.00
FR4340:St5 UTSW 7 109556921 unclassified probably benign
FR4737:St5 UTSW 7 109556921 unclassified probably benign
PIT4466001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4469001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4472001:St5 UTSW 7 109531130 missense probably damaging 1.00
R0024:St5 UTSW 7 109524659 missense probably damaging 1.00
R0124:St5 UTSW 7 109542511 missense possibly damaging 0.66
R0125:St5 UTSW 7 109556338 missense probably benign 0.19
R0365:St5 UTSW 7 109538949 missense probably damaging 1.00
R0491:St5 UTSW 7 109557204 missense probably benign 0.45
R0534:St5 UTSW 7 109541428 missense probably damaging 1.00
R0662:St5 UTSW 7 109557426 missense probably damaging 1.00
R0743:St5 UTSW 7 109557345 missense probably damaging 1.00
R0772:St5 UTSW 7 109542320 splice site probably null
R0774:St5 UTSW 7 109542320 splice site probably null
R0787:St5 UTSW 7 109525620 missense possibly damaging 0.94
R0884:St5 UTSW 7 109557345 missense probably damaging 1.00
R1518:St5 UTSW 7 109557355 missense probably damaging 1.00
R1908:St5 UTSW 7 109525326 nonsense probably null
R1909:St5 UTSW 7 109525326 nonsense probably null
R2232:St5 UTSW 7 109557207 missense probably benign
R2358:St5 UTSW 7 109556446 missense probably benign 0.01
R2847:St5 UTSW 7 109525337 missense probably damaging 1.00
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2873:St5 UTSW 7 109557430 missense probably benign 0.01
R2874:St5 UTSW 7 109557430 missense probably benign 0.01
R4534:St5 UTSW 7 109531156 missense probably damaging 1.00
R4536:St5 UTSW 7 109531156 missense probably damaging 1.00
R4559:St5 UTSW 7 109525578 missense probably damaging 1.00
R4846:St5 UTSW 7 109556836 nonsense probably null
R5110:St5 UTSW 7 109542490 missense probably benign 0.02
R5181:St5 UTSW 7 109556790 missense probably benign
R5268:St5 UTSW 7 109557312 missense probably benign
R5403:St5 UTSW 7 109556905 missense probably damaging 1.00
R5836:St5 UTSW 7 109541345 missense possibly damaging 0.78
R5932:St5 UTSW 7 109570016 missense probably damaging 1.00
R5937:St5 UTSW 7 109557271 missense possibly damaging 0.86
R6180:St5 UTSW 7 109556888 missense probably benign 0.11
R6741:St5 UTSW 7 109545097 missense possibly damaging 0.95
R6781:St5 UTSW 7 109525304 missense possibly damaging 0.83
R7086:St5 UTSW 7 109525574 missense probably damaging 1.00
X0067:St5 UTSW 7 109556240 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCAGAGAAGGTCCTGCTC -3'
(R):5'- AGCTATTTGGACAGAACCCC -3'

Sequencing Primer
(F):5'- AGAGAAGGTCCTGCTCATCCTC -3'
(R):5'- ATTTGGACAGAACCCCTTCATTACG -3'
Posted On2016-02-04