Incidental Mutation 'R4798:Muc2'
ID369217
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Namemucin 2
Synonyms2010015E03Rik
MMRRC Submission 042422-MU
Accession Numbers

Genbank: BC034197; MGI: 1339364

Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4798 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141690340-141754693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 141754140 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 834 (N834K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026590]
Predicted Effect probably benign
Transcript: ENSMUST00000026590
AA Change: N395K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: N395K

DomainStartEndE-ValueType
C8 1 63 1.65e-11 SMART
VWC 120 188 5.48e-2 SMART
VWC 229 293 2.38e-11 SMART
Blast:VWD 299 363 4e-17 BLAST
CT 380 463 3.6e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187945
AA Change: N834K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (111/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,624,965 D617E probably benign Het
2210408I21Rik T C 13: 77,323,724 W1083R possibly damaging Het
Adamts10 T A 17: 33,528,752 L54Q probably damaging Het
Ankrd24 A C 10: 81,643,315 probably benign Het
Atg2b A G 12: 105,652,629 S813P probably benign Het
Atp13a3 T A 16: 30,341,240 I716F probably damaging Het
Atp6v1c1 T A 15: 38,689,176 W294R probably damaging Het
Atrnl1 G T 19: 58,042,361 A1312S probably benign Het
B230359F08Rik T A 14: 53,795,951 C106S probably damaging Het
Bcl2 A T 1: 106,712,608 H91Q possibly damaging Het
Cacna1c G A 6: 118,630,302 Q1214* probably null Het
Cacna1g C A 11: 94,433,847 G1183W probably damaging Het
Capsl A T 15: 9,461,742 M75L probably benign Het
Ccdc122 T G 14: 77,111,607 probably benign Het
Ccdc57 T G 11: 120,881,857 R645S possibly damaging Het
Cdh8 T A 8: 99,024,926 R720* probably null Het
Cenpx T G 11: 120,711,784 probably benign Het
Clic3 T C 2: 25,458,182 S114P probably damaging Het
Crtac1 A T 19: 42,323,801 W158R possibly damaging Het
Dhrs11 T A 11: 84,828,800 Q33L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpp9 G T 17: 56,191,016 Q647K probably damaging Het
Egf C T 3: 129,716,678 G64D probably damaging Het
Eif2b4 C T 5: 31,189,520 probably benign Het
Epas1 A G 17: 86,805,839 N151S probably benign Het
Fastkd1 A T 2: 69,691,307 I707K probably benign Het
Fbln2 A G 6: 91,269,186 T1005A probably benign Het
Fgfrl1 T A 5: 108,703,497 Y93* probably null Het
Fktn A G 4: 53,744,637 T306A probably benign Het
Gabbr2 T G 4: 46,991,139 Y96S possibly damaging Het
Gm16332 A T 1: 139,891,658 noncoding transcript Het
Gm5145 G T 17: 20,570,548 V63F probably damaging Het
Gm9970 G T 5: 31,241,085 probably benign Het
Gpr158 A G 2: 21,783,182 T545A probably damaging Het
Heatr1 G A 13: 12,412,048 E685K probably benign Het
Herc6 A T 6: 57,604,166 I284F probably damaging Het
Hook1 C G 4: 96,002,557 A301G possibly damaging Het
Hpcal4 T A 4: 123,190,698 M140K possibly damaging Het
Il11ra1 T C 4: 41,766,096 probably benign Het
Ildr1 A T 16: 36,722,555 H439L possibly damaging Het
Itga11 A G 9: 62,776,727 probably null Het
Jag2 A T 12: 112,916,632 D337E probably benign Het
Krt82 C T 15: 101,550,488 R39Q probably benign Het
L3mbtl4 T A 17: 68,359,480 M1K probably null Het
Lrrc32 T G 7: 98,499,017 F335V probably damaging Het
Lurap1l T A 4: 80,911,413 V20E probably damaging Het
Lyar T A 5: 38,227,886 V90D possibly damaging Het
Man2c1 C T 9: 57,141,185 R778* probably null Het
Mapk6 A G 9: 75,388,432 F595L probably benign Het
Mccc1 A G 3: 35,985,001 I281T probably damaging Het
Mep1b T C 18: 21,093,254 V391A probably damaging Het
Mier1 G A 4: 103,130,998 D40N probably damaging Het
Mkx T C 18: 7,002,432 H38R probably benign Het
Mroh4 A G 15: 74,626,179 L184P probably damaging Het
Mycl A G 4: 123,000,256 D283G probably damaging Het
Myh6 T C 14: 54,953,293 N975S probably damaging Het
Myl12a A G 17: 70,996,302 probably benign Het
Mysm1 T C 4: 94,965,673 T230A probably benign Het
Naca A G 10: 128,047,803 K2099R probably null Het
Nbeal1 T G 1: 60,222,193 probably null Het
Nedd1 A G 10: 92,698,910 V246A probably benign Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Ninl G A 2: 150,959,881 R156* probably null Het
Obscn T A 11: 59,069,859 I3418F probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Pappa2 T C 1: 158,857,379 N730S probably damaging Het
Pcm1 G A 8: 41,293,678 D1305N probably damaging Het
Pcsk4 A T 10: 80,323,104 I485N probably damaging Het
Phldb2 T C 16: 45,825,874 R111G probably damaging Het
Prdm10 T C 9: 31,341,273 F385S probably damaging Het
Prkcsh C T 9: 22,011,738 P351L probably damaging Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Rad51c T C 11: 87,395,378 D251G probably damaging Het
Radil A G 5: 142,485,163 F1088L probably benign Het
Rere C A 4: 150,615,167 probably benign Het
Rnf167 T A 11: 70,650,135 C196S probably benign Het
Robo2 T A 16: 74,352,745 Y65F probably damaging Het
Scarf2 G A 16: 17,803,507 C319Y probably damaging Het
Sec24c A G 14: 20,693,712 D995G probably damaging Het
Selenbp1 T C 3: 94,943,900 L369S probably benign Het
Sgpl1 A T 10: 61,123,344 I53K possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc1a6 A T 10: 78,800,118 Y339F probably damaging Het
Smchd1 G T 17: 71,360,053 Y1781* probably null Het
Smg1 T C 7: 118,180,474 S1233G probably benign Het
Snap91 A T 9: 86,783,454 probably benign Het
Snx29 T A 16: 11,420,736 L112Q probably damaging Het
Sptbn5 T C 2: 120,059,141 probably benign Het
Srl A T 16: 4,492,358 H502Q possibly damaging Het
St5 C T 7: 109,557,033 G170D probably damaging Het
St8sia3 A G 18: 64,271,749 M366V probably benign Het
Stk19 A T 17: 34,822,509 probably benign Het
Syngap1 G A 17: 26,961,449 A611T probably benign Het
Tas2r113 A G 6: 132,893,707 T233A possibly damaging Het
Tbcc G A 17: 46,891,219 W177* probably null Het
Tcstv3 T A 13: 120,318,082 probably null Het
Trmt61a G A 12: 111,678,713 V28M possibly damaging Het
Ubap2l G A 3: 90,020,903 T553M probably damaging Het
Urb1 T C 16: 90,757,827 N1839S probably benign Het
Ush2a T C 1: 188,743,545 L2893P probably damaging Het
Usp24 G A 4: 106,360,162 V421M possibly damaging Het
Vmn1r43 T C 6: 89,869,910 E198G probably benign Het
Vps13d A C 4: 145,178,056 S130A probably damaging Het
Zfp426 T A 9: 20,471,014 I211F probably benign Het
Znfx1 T C 2: 167,038,569 probably null Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141693356 missense probably benign 0.35
kenny APN 7 nonsense
Winnie APN 7 141699460 missense probably damaging 1.00
IGL01303:Muc2 APN 7 141752395 missense probably benign
IGL01482:Muc2 APN 7 141754060 missense probably damaging 0.96
IGL01875:Muc2 APN 7 141752740 missense probably damaging 0.99
IGL02088:Muc2 APN 7 141751504 missense probably damaging 1.00
IGL02415:Muc2 APN 7 141751872 nonsense probably null
IGL02548:Muc2 APN 7 141751857 missense probably damaging 1.00
IGL02836:Muc2 APN 7 141746713 unclassified probably benign
IGL03196:Muc2 APN 7 141747630 missense probably damaging 0.97
Muskatenwein UTSW 7 141753439 missense unknown
nomoco UTSW 7 141753719 missense probably damaging 1.00
Schlendrian UTSW 7 141695682 missense probably damaging 1.00
Seco UTSW 7 141698733 missense probably damaging 1.00
E0370:Muc2 UTSW 7 141696355 missense probably damaging 1.00
R0127:Muc2 UTSW 7 141748954 missense probably benign 0.00
R0179:Muc2 UTSW 7 141748971 missense probably damaging 1.00
R0201:Muc2 UTSW 7 141699185 frame shift probably null
R0299:Muc2 UTSW 7 141752729 missense probably damaging 1.00
R0547:Muc2 UTSW 7 141699185 frame shift probably null
R0699:Muc2 UTSW 7 141752300 missense probably damaging 1.00
R0900:Muc2 UTSW 7 141699185 frame shift probably null
R1348:Muc2 UTSW 7 141699185 frame shift probably null
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1625:Muc2 UTSW 7 141697162 missense probably damaging 1.00
R2010:Muc2 UTSW 7 141700875 missense probably damaging 0.99
R2149:Muc2 UTSW 7 141699185 frame shift probably null
R2163:Muc2 UTSW 7 141699185 frame shift probably null
R3008:Muc2 UTSW 7 141695104 missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141745488 unclassified probably benign
R3112:Muc2 UTSW 7 141745488 unclassified probably benign
R3424:Muc2 UTSW 7 141693352 missense probably damaging 0.99
R3786:Muc2 UTSW 7 141697347 missense probably benign 0.01
R3854:Muc2 UTSW 7 141754344 missense probably damaging 1.00
R3964:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3965:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3966:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3973:Muc2 UTSW 7 141746804 unclassified probably benign
R3974:Muc2 UTSW 7 141746804 unclassified probably benign
R3976:Muc2 UTSW 7 141746804 unclassified probably benign
R4327:Muc2 UTSW 7 141695334 missense probably damaging 0.96
R4694:Muc2 UTSW 7 141752345 missense probably damaging 1.00
R4764:Muc2 UTSW 7 141745608 missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141699691 critical splice donor site probably null
R4900:Muc2 UTSW 7 141749543 missense probably benign 0.32
R5383:Muc2 UTSW 7 141753719 missense probably damaging 1.00
R5489:Muc2 UTSW 7 141751432 missense probably benign 0.00
R5615:Muc2 UTSW 7 141691203 missense probably damaging 1.00
R5856:Muc2 UTSW 7 141745644 unclassified probably benign
R5919:Muc2 UTSW 7 141694928 missense probably damaging 0.97
R5953:Muc2 UTSW 7 141701382 missense probably damaging 0.96
R5979:Muc2 UTSW 7 141697250 unclassified probably null
R5979:Muc2 UTSW 7 141751406 missense probably damaging 0.99
R6175:Muc2 UTSW 7 141696632 missense probably damaging 1.00
R6213:Muc2 UTSW 7 141751414 missense probably damaging 1.00
R6281:Muc2 UTSW 7 141752403 missense probably damaging 1.00
R6321:Muc2 UTSW 7 141700828 missense probably benign 0.28
R6390:Muc2 UTSW 7 141752146 missense probably damaging 0.97
R6485:Muc2 UTSW 7 141746736 unclassified probably benign
R6582:Muc2 UTSW 7 141696698 missense probably benign 0.00
R6683:Muc2 UTSW 7 141751477 missense probably benign 0.38
R6896:Muc2 UTSW 7 141752695 missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141698733 missense probably damaging 1.00
R6924:Muc2 UTSW 7 141697834 missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141751457 missense unknown
R7222:Muc2 UTSW 7 141704209 missense
R7251:Muc2 UTSW 7 141692722 missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141752744 missense
R7315:Muc2 UTSW 7 141690402 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTAAGGGCTAGAGACATGCTC -3'
(R):5'- AGAGCACCTGTGATCCAGAC -3'

Sequencing Primer
(F):5'- GAGACATGCTCGGAGAAGG -3'
(R):5'- TGGACCTGGGCAGAGTAC -3'
Posted On2016-02-04