Incidental Mutation 'R0419:Kcnu1'
ID36925
Institutional Source Beutler Lab
Gene Symbol Kcnu1
Ensembl Gene ENSMUSG00000031576
Gene Namepotassium channel, subfamily U, member 1
SynonymsKcnma3, Slo3
MMRRC Submission 038621-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0419 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25849623-25937939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25937618 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 321 (N321I)
Ref Sequence ENSEMBL: ENSMUSP00000113442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098858] [ENSMUST00000120653]
Predicted Effect probably benign
Transcript: ENSMUST00000098858
AA Change: N1061I

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000096457
Gene: ENSMUSG00000031576
AA Change: N1061I

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Pfam:Ion_trans 101 323 6.9e-21 PFAM
Pfam:Ion_trans_2 229 317 4.7e-12 PFAM
low complexity region 367 380 N/A INTRINSIC
Pfam:BK_channel_a 462 557 1.2e-28 PFAM
low complexity region 670 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120653
AA Change: N321I

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113442
Gene: ENSMUSG00000031576
AA Change: N321I

DomainStartEndE-ValueType
PDB:4HPF|B 1 332 1e-144 PDB
Meta Mutation Damage Score 0.1592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium channel family of proteins. The encoded voltage-gated ion channel allows the outward flow of potassium ions during plasma membrane hyperpolarization in sperm. Opening of this channel may be regulated by calcium ion levels. Homozygous knockout mice that lack the related mouse gene exhibit male sterility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous male mutants are infertile with impaired sperm capacitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,842 probably benign Het
2210010C04Rik T C 6: 41,034,347 N34D probably benign Het
5730507C01Rik A T 12: 18,533,423 R161S possibly damaging Het
Adamts5 T C 16: 85,866,642 I735V probably benign Het
Arid1a G T 4: 133,681,124 P2024Q unknown Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
B3galt4 T C 17: 33,950,790 Y158C probably damaging Het
BC049715 A G 6: 136,840,145 T128A possibly damaging Het
Btaf1 T A 19: 36,945,229 I11N probably damaging Het
Cfb T C 17: 34,858,509 I496V probably damaging Het
Chd8 A T 14: 52,204,060 H858Q probably benign Het
Chrne T C 11: 70,615,723 I324V probably benign Het
Clec14a T C 12: 58,267,665 I390M probably damaging Het
Cpsf3 A G 12: 21,297,799 Y207C probably damaging Het
Cubn A C 2: 13,469,763 I410S possibly damaging Het
Cubn T A 2: 13,469,764 I410F possibly damaging Het
Dlc1 T C 8: 36,583,586 E997G possibly damaging Het
Emilin1 G T 5: 30,915,022 V71F probably damaging Het
Esrp2 T C 8: 106,134,675 E164G probably damaging Het
Fars2 A G 13: 36,537,311 T410A probably benign Het
Fat3 A G 9: 15,992,256 V2981A probably damaging Het
Fkbp15 G A 4: 62,326,136 T472I probably benign Het
Gm6871 A G 7: 41,573,445 V73A probably benign Het
Gnl2 T G 4: 125,053,527 S647R probably benign Het
Grb10 T C 11: 11,934,207 I500V possibly damaging Het
Herc1 T C 9: 66,446,074 probably benign Het
Iqgap2 A C 13: 95,689,699 probably null Het
Kif23 G A 9: 61,926,405 R519* probably null Het
Klhl1 C T 14: 96,381,789 R224Q probably benign Het
Lama1 T C 17: 67,791,610 probably null Het
Lamp3 T C 16: 19,673,552 Y314C probably damaging Het
Lamtor5 C A 3: 107,281,911 R88S probably damaging Het
Nbea G T 3: 55,819,294 A2088E probably benign Het
Neo1 A G 9: 58,990,180 probably benign Het
Ntn4 A T 10: 93,682,429 R199S probably benign Het
Olfr1020 A T 2: 85,849,967 R172* probably null Het
Plekho2 A G 9: 65,557,052 S172P possibly damaging Het
Pmp2 T C 3: 10,180,763 Y129C probably damaging Het
Ralgapa2 A T 2: 146,428,672 M578K possibly damaging Het
Ranbp3 C T 17: 56,708,219 T307M possibly damaging Het
Serpinb11 G A 1: 107,376,860 W185* probably null Het
Setdb2 A T 14: 59,406,744 probably null Het
Sirpb1b A T 3: 15,548,596 V75E probably damaging Het
Slc13a1 A T 6: 24,100,293 L397Q probably damaging Het
Slc19a1 T A 10: 77,042,908 I355N probably damaging Het
Slc51a T A 16: 32,476,436 I275F possibly damaging Het
Spink14 T C 18: 44,031,867 S84P probably damaging Het
Stx2 A G 5: 128,993,577 probably benign Het
Tgfbi G T 13: 56,632,193 probably benign Het
Tshr T A 12: 91,537,869 M527K probably damaging Het
Upb1 T C 10: 75,412,883 V79A probably damaging Het
Zdhhc5 A T 2: 84,691,243 probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp280d T C 9: 72,312,237 V32A probably benign Het
Other mutations in Kcnu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Kcnu1 APN 8 25897856 missense probably benign 0.00
IGL00580:Kcnu1 APN 8 25865663 missense probably benign 0.04
IGL00675:Kcnu1 APN 8 25851849 missense probably benign
IGL00928:Kcnu1 APN 8 25849735 missense probably damaging 1.00
IGL01324:Kcnu1 APN 8 25849707 missense probably benign 0.22
IGL01346:Kcnu1 APN 8 25934523 splice site probably benign
IGL01361:Kcnu1 APN 8 25886768 missense possibly damaging 0.78
IGL01651:Kcnu1 APN 8 25861095 missense probably damaging 1.00
IGL01795:Kcnu1 APN 8 25913705 missense probably damaging 1.00
IGL01800:Kcnu1 APN 8 25937500 missense probably damaging 1.00
IGL01975:Kcnu1 APN 8 25934497 missense probably benign 0.29
IGL02103:Kcnu1 APN 8 25905948 missense possibly damaging 0.83
IGL02109:Kcnu1 APN 8 25937699 missense possibly damaging 0.66
IGL02127:Kcnu1 APN 8 25892062 missense probably damaging 1.00
IGL02170:Kcnu1 APN 8 25937560 missense probably damaging 1.00
IGL02217:Kcnu1 APN 8 25858184 missense probably damaging 1.00
IGL02385:Kcnu1 APN 8 25932270 missense probably damaging 1.00
IGL02493:Kcnu1 APN 8 25937520 missense possibly damaging 0.68
IGL02883:Kcnu1 APN 8 25849827 missense probably benign
IGL02884:Kcnu1 APN 8 25921528 missense probably damaging 1.00
IGL03022:Kcnu1 APN 8 25937586 missense probably damaging 0.98
IGL03281:Kcnu1 APN 8 25892077 missense probably null 1.00
IGL03345:Kcnu1 APN 8 25881293 splice site probably benign
P0026:Kcnu1 UTSW 8 25892122 missense probably damaging 1.00
R0001:Kcnu1 UTSW 8 25859270 missense probably damaging 1.00
R0518:Kcnu1 UTSW 8 25910888 missense probably damaging 1.00
R0521:Kcnu1 UTSW 8 25910888 missense probably damaging 1.00
R0581:Kcnu1 UTSW 8 25937501 missense probably damaging 1.00
R0840:Kcnu1 UTSW 8 25913684 start codon destroyed probably null 1.00
R1282:Kcnu1 UTSW 8 25905957 missense probably benign 0.02
R1556:Kcnu1 UTSW 8 25861191 critical splice donor site probably null
R1600:Kcnu1 UTSW 8 25849793 missense probably damaging 1.00
R2011:Kcnu1 UTSW 8 25918442 missense probably benign 0.03
R2035:Kcnu1 UTSW 8 25896693 missense probably benign 0.35
R2082:Kcnu1 UTSW 8 25921549 missense probably damaging 1.00
R2132:Kcnu1 UTSW 8 25851900 missense probably damaging 0.99
R2415:Kcnu1 UTSW 8 25910878 missense probably benign
R2513:Kcnu1 UTSW 8 25905966 missense probably benign 0.00
R3712:Kcnu1 UTSW 8 25881420 missense probably damaging 1.00
R3749:Kcnu1 UTSW 8 25886770 missense probably null 0.01
R3840:Kcnu1 UTSW 8 25885352 missense possibly damaging 0.95
R3874:Kcnu1 UTSW 8 25885317 missense probably damaging 1.00
R4184:Kcnu1 UTSW 8 25862417 missense probably damaging 1.00
R4576:Kcnu1 UTSW 8 25890020 missense probably benign 0.06
R4658:Kcnu1 UTSW 8 25937555 missense probably damaging 1.00
R4667:Kcnu1 UTSW 8 25910921 missense possibly damaging 0.69
R4791:Kcnu1 UTSW 8 25913752 missense probably damaging 1.00
R4940:Kcnu1 UTSW 8 25897862 splice site probably null
R5120:Kcnu1 UTSW 8 25934488 missense possibly damaging 0.79
R5314:Kcnu1 UTSW 8 25862458 missense probably damaging 0.97
R5712:Kcnu1 UTSW 8 25919650 missense probably damaging 1.00
R5807:Kcnu1 UTSW 8 25849714 missense possibly damaging 0.78
R6237:Kcnu1 UTSW 8 25932334 missense probably benign
R6260:Kcnu1 UTSW 8 25851891 missense probably damaging 1.00
R6360:Kcnu1 UTSW 8 25861180 missense possibly damaging 0.73
R6612:Kcnu1 UTSW 8 25918316 missense probably benign 0.10
R6708:Kcnu1 UTSW 8 25937711 missense probably benign
R6765:Kcnu1 UTSW 8 25913645 missense probably damaging 1.00
R6816:Kcnu1 UTSW 8 25937734 nonsense probably null
R7030:Kcnu1 UTSW 8 25918463 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATGATAACAGCCGCCCGCAGAG -3'
(R):5'- TCACTGGCATCTAACGTGTCCAAAG -3'

Sequencing Primer
(F):5'- CAGAGAGTTCCGATGCTATGC -3'
(R):5'- TCTAACGTGTCCAAAGGATAGACTC -3'
Posted On2013-05-09