Incidental Mutation 'R0419:Dlc1'
ID36926
Institutional Source Beutler Lab
Gene Symbol Dlc1
Ensembl Gene ENSMUSG00000031523
Gene Namedeleted in liver cancer 1
SynonymsArhgap7, A730069N07Rik, STARD12, p122-RhoGAP
MMRRC Submission 038621-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0419 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location36567751-36953143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36583586 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 997 (E997G)
Ref Sequence ENSEMBL: ENSMUSP00000132812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033923] [ENSMUST00000098826] [ENSMUST00000163663]
Predicted Effect probably benign
Transcript: ENSMUST00000033923
AA Change: E546G

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000033923
Gene: ENSMUSG00000031523
AA Change: E546G

DomainStartEndE-ValueType
Pfam:SAM_2 15 76 2.2e-7 PFAM
low complexity region 154 174 N/A INTRINSIC
low complexity region 238 250 N/A INTRINSIC
low complexity region 298 325 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
RhoGAP 653 845 8.82e-59 SMART
START 887 1088 3.93e-59 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098826
AA Change: E580G

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096425
Gene: ENSMUSG00000031523
AA Change: E580G

DomainStartEndE-ValueType
Pfam:SAM_2 49 110 5.9e-8 PFAM
low complexity region 188 208 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 332 359 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
RhoGAP 687 879 8.82e-59 SMART
START 921 1122 3.93e-59 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163663
AA Change: E997G

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132812
Gene: ENSMUSG00000031523
AA Change: E997G

DomainStartEndE-ValueType
low complexity region 353 369 N/A INTRINSIC
low complexity region 388 403 N/A INTRINSIC
Pfam:SAM_2 466 527 1.2e-7 PFAM
low complexity region 605 625 N/A INTRINSIC
low complexity region 689 701 N/A INTRINSIC
low complexity region 749 776 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
RhoGAP 1104 1296 8.82e-59 SMART
START 1338 1539 3.93e-59 SMART
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins. GAP family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. This gene functions as a tumor suppressor gene in a number of common cancers, including prostate, lung, colorectal, and breast cancers. Multiple transcript variants due to alternative promoters and alternative splicing have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutants die by E10.5 with variable defects in the neural tube, heart, brain and placenta. Mouse embryonic fibroblasts homozygous for an activated conditional allele exhibti increased sensitivity to Ras-induced transformation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,842 probably benign Het
2210010C04Rik T C 6: 41,034,347 N34D probably benign Het
5730507C01Rik A T 12: 18,533,423 R161S possibly damaging Het
Adamts5 T C 16: 85,866,642 I735V probably benign Het
Arid1a G T 4: 133,681,124 P2024Q unknown Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
B3galt4 T C 17: 33,950,790 Y158C probably damaging Het
BC049715 A G 6: 136,840,145 T128A possibly damaging Het
Btaf1 T A 19: 36,945,229 I11N probably damaging Het
Cfb T C 17: 34,858,509 I496V probably damaging Het
Chd8 A T 14: 52,204,060 H858Q probably benign Het
Chrne T C 11: 70,615,723 I324V probably benign Het
Clec14a T C 12: 58,267,665 I390M probably damaging Het
Cpsf3 A G 12: 21,297,799 Y207C probably damaging Het
Cubn A C 2: 13,469,763 I410S possibly damaging Het
Cubn T A 2: 13,469,764 I410F possibly damaging Het
Emilin1 G T 5: 30,915,022 V71F probably damaging Het
Esrp2 T C 8: 106,134,675 E164G probably damaging Het
Fars2 A G 13: 36,537,311 T410A probably benign Het
Fat3 A G 9: 15,992,256 V2981A probably damaging Het
Fkbp15 G A 4: 62,326,136 T472I probably benign Het
Gm6871 A G 7: 41,573,445 V73A probably benign Het
Gnl2 T G 4: 125,053,527 S647R probably benign Het
Grb10 T C 11: 11,934,207 I500V possibly damaging Het
Herc1 T C 9: 66,446,074 probably benign Het
Iqgap2 A C 13: 95,689,699 probably null Het
Kcnu1 A T 8: 25,937,618 N321I probably benign Het
Kif23 G A 9: 61,926,405 R519* probably null Het
Klhl1 C T 14: 96,381,789 R224Q probably benign Het
Lama1 T C 17: 67,791,610 probably null Het
Lamp3 T C 16: 19,673,552 Y314C probably damaging Het
Lamtor5 C A 3: 107,281,911 R88S probably damaging Het
Nbea G T 3: 55,819,294 A2088E probably benign Het
Neo1 A G 9: 58,990,180 probably benign Het
Ntn4 A T 10: 93,682,429 R199S probably benign Het
Olfr1020 A T 2: 85,849,967 R172* probably null Het
Plekho2 A G 9: 65,557,052 S172P possibly damaging Het
Pmp2 T C 3: 10,180,763 Y129C probably damaging Het
Ralgapa2 A T 2: 146,428,672 M578K possibly damaging Het
Ranbp3 C T 17: 56,708,219 T307M possibly damaging Het
Serpinb11 G A 1: 107,376,860 W185* probably null Het
Setdb2 A T 14: 59,406,744 probably null Het
Sirpb1b A T 3: 15,548,596 V75E probably damaging Het
Slc13a1 A T 6: 24,100,293 L397Q probably damaging Het
Slc19a1 T A 10: 77,042,908 I355N probably damaging Het
Slc51a T A 16: 32,476,436 I275F possibly damaging Het
Spink14 T C 18: 44,031,867 S84P probably damaging Het
Stx2 A G 5: 128,993,577 probably benign Het
Tgfbi G T 13: 56,632,193 probably benign Het
Tshr T A 12: 91,537,869 M527K probably damaging Het
Upb1 T C 10: 75,412,883 V79A probably damaging Het
Zdhhc5 A T 2: 84,691,243 probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp280d T C 9: 72,312,237 V32A probably benign Het
Other mutations in Dlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dlc1 APN 8 36570282 utr 3 prime probably benign
IGL00807:Dlc1 APN 8 36572848 missense probably benign 0.01
IGL00924:Dlc1 APN 8 36938214 missense probably benign
IGL01349:Dlc1 APN 8 36583824 missense probably damaging 0.96
IGL01419:Dlc1 APN 8 36850217 missense probably benign 0.02
IGL01871:Dlc1 APN 8 36850180 missense probably damaging 0.99
IGL01937:Dlc1 APN 8 36850191 missense probably benign 0.25
IGL02525:Dlc1 APN 8 36579646 missense probably damaging 1.00
IGL02696:Dlc1 APN 8 36574172 missense possibly damaging 0.65
IGL02826:Dlc1 APN 8 36570275 utr 3 prime probably benign
IGL03029:Dlc1 APN 8 36571262 splice site probably null
IGL02835:Dlc1 UTSW 8 36583901 missense probably damaging 1.00
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0218:Dlc1 UTSW 8 36850229 missense probably benign
R0513:Dlc1 UTSW 8 36584010 missense probably damaging 1.00
R0645:Dlc1 UTSW 8 36574049 missense possibly damaging 0.60
R0646:Dlc1 UTSW 8 36858051 missense probably benign
R0727:Dlc1 UTSW 8 36572674 missense probably damaging 0.99
R0792:Dlc1 UTSW 8 36938548 missense probably benign 0.00
R1061:Dlc1 UTSW 8 36858051 missense probably benign
R1221:Dlc1 UTSW 8 36584831 missense probably benign
R1440:Dlc1 UTSW 8 36593463 splice site probably benign
R1501:Dlc1 UTSW 8 36938148 missense probably benign 0.06
R1606:Dlc1 UTSW 8 36850252 missense probably benign
R1707:Dlc1 UTSW 8 36937609 missense probably benign 0.03
R1750:Dlc1 UTSW 8 36858090 splice site probably null
R1762:Dlc1 UTSW 8 36937585 missense probably benign 0.25
R2041:Dlc1 UTSW 8 36582768 missense probably damaging 1.00
R2055:Dlc1 UTSW 8 36593381 missense probably damaging 0.98
R2091:Dlc1 UTSW 8 36937609 missense probably benign 0.00
R2987:Dlc1 UTSW 8 36574152 missense probably damaging 0.97
R4285:Dlc1 UTSW 8 36574128 missense possibly damaging 0.49
R4294:Dlc1 UTSW 8 36584753 missense possibly damaging 0.47
R4631:Dlc1 UTSW 8 36937558 critical splice donor site probably null
R4828:Dlc1 UTSW 8 36850246 missense possibly damaging 0.69
R4867:Dlc1 UTSW 8 36584645 missense probably benign 0.01
R4902:Dlc1 UTSW 8 36577131 missense probably damaging 1.00
R5067:Dlc1 UTSW 8 36584493 missense probably benign 0.04
R5068:Dlc1 UTSW 8 36938030 missense probably benign
R5198:Dlc1 UTSW 8 36938398 missense probably damaging 1.00
R5471:Dlc1 UTSW 8 36584725 missense probably benign 0.26
R5668:Dlc1 UTSW 8 36937501 unclassified probably benign
R5915:Dlc1 UTSW 8 36938675 utr 5 prime probably benign
R6323:Dlc1 UTSW 8 36938383 missense possibly damaging 0.62
R6655:Dlc1 UTSW 8 36572716 missense probably damaging 1.00
R6908:Dlc1 UTSW 8 36937687 missense probably benign 0.02
R6914:Dlc1 UTSW 8 36938210 missense probably benign
R6942:Dlc1 UTSW 8 36938210 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCCACTGTCTGCATCCTTGATGAC -3'
(R):5'- CAGCCGCCTGAGCATCTATGATAAC -3'

Sequencing Primer
(F):5'- GCATCCTTGATGACCAAAGGTTC -3'
(R):5'- CTGGAGAATGAGGACATCTTCCC -3'
Posted On2013-05-09