Incidental Mutation 'R4798:Dnah8'
ID369268
Institutional Source Beutler Lab
Gene Symbol Dnah8
Ensembl Gene ENSMUSG00000033826
Gene Namedynein, axonemal, heavy chain 8
SynonymsDnahc8, P1-Loop, Hst6.7b
MMRRC Submission 042422-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R4798 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location30624354-30875264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30748568 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 2585 (D2585N)
Ref Sequence ENSEMBL: ENSMUSP00000127878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170651]
Predicted Effect probably benign
Transcript: ENSMUST00000170651
AA Change: D2585N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: D2585N

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
Pfam:DHC_N1 379 936 8.4e-159 PFAM
low complexity region 1069 1080 N/A INTRINSIC
low complexity region 1224 1237 N/A INTRINSIC
Pfam:DHC_N2 1509 1917 1.6e-134 PFAM
AAA 2082 2226 1.38e-1 SMART
AAA 2363 2516 2.04e-1 SMART
AAA 2689 2837 8.15e-2 SMART
Pfam:AAA_8 3022 3294 4e-72 PFAM
Pfam:MT 3306 3656 3.6e-48 PFAM
Pfam:AAA_9 3676 3901 6.7e-85 PFAM
Pfam:Dynein_heavy 4039 4728 8.4e-250 PFAM
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (111/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,624,965 D617E probably benign Het
2210408I21Rik T C 13: 77,323,724 W1083R possibly damaging Het
Adamts10 T A 17: 33,528,752 L54Q probably damaging Het
Ankrd24 A C 10: 81,643,315 probably benign Het
Atg2b A G 12: 105,652,629 S813P probably benign Het
Atp13a3 T A 16: 30,341,240 I716F probably damaging Het
Atp6v1c1 T A 15: 38,689,176 W294R probably damaging Het
Atrnl1 G T 19: 58,042,361 A1312S probably benign Het
B230359F08Rik T A 14: 53,795,951 C106S probably damaging Het
Bcl2 A T 1: 106,712,608 H91Q possibly damaging Het
Cacna1c G A 6: 118,630,302 Q1214* probably null Het
Cacna1g C A 11: 94,433,847 G1183W probably damaging Het
Capsl A T 15: 9,461,742 M75L probably benign Het
Ccdc122 T G 14: 77,111,607 probably benign Het
Ccdc57 T G 11: 120,881,857 R645S possibly damaging Het
Cdh8 T A 8: 99,024,926 R720* probably null Het
Cenpx T G 11: 120,711,784 probably benign Het
Clic3 T C 2: 25,458,182 S114P probably damaging Het
Crtac1 A T 19: 42,323,801 W158R possibly damaging Het
Dhrs11 T A 11: 84,828,800 Q33L probably benign Het
Dpp9 G T 17: 56,191,016 Q647K probably damaging Het
Egf C T 3: 129,716,678 G64D probably damaging Het
Eif2b4 C T 5: 31,189,520 probably benign Het
Epas1 A G 17: 86,805,839 N151S probably benign Het
Fastkd1 A T 2: 69,691,307 I707K probably benign Het
Fbln2 A G 6: 91,269,186 T1005A probably benign Het
Fgfrl1 T A 5: 108,703,497 Y93* probably null Het
Fktn A G 4: 53,744,637 T306A probably benign Het
Gabbr2 T G 4: 46,991,139 Y96S possibly damaging Het
Gm16332 A T 1: 139,891,658 noncoding transcript Het
Gm5145 G T 17: 20,570,548 V63F probably damaging Het
Gm9970 G T 5: 31,241,085 probably benign Het
Gpr158 A G 2: 21,783,182 T545A probably damaging Het
Heatr1 G A 13: 12,412,048 E685K probably benign Het
Herc6 A T 6: 57,604,166 I284F probably damaging Het
Hook1 C G 4: 96,002,557 A301G possibly damaging Het
Hpcal4 T A 4: 123,190,698 M140K possibly damaging Het
Il11ra1 T C 4: 41,766,096 probably benign Het
Ildr1 A T 16: 36,722,555 H439L possibly damaging Het
Itga11 A G 9: 62,776,727 probably null Het
Jag2 A T 12: 112,916,632 D337E probably benign Het
Krt82 C T 15: 101,550,488 R39Q probably benign Het
L3mbtl4 T A 17: 68,359,480 M1K probably null Het
Lrrc32 T G 7: 98,499,017 F335V probably damaging Het
Lurap1l T A 4: 80,911,413 V20E probably damaging Het
Lyar T A 5: 38,227,886 V90D possibly damaging Het
Man2c1 C T 9: 57,141,185 R778* probably null Het
Mapk6 A G 9: 75,388,432 F595L probably benign Het
Mccc1 A G 3: 35,985,001 I281T probably damaging Het
Mep1b T C 18: 21,093,254 V391A probably damaging Het
Mier1 G A 4: 103,130,998 D40N probably damaging Het
Mkx T C 18: 7,002,432 H38R probably benign Het
Mroh4 A G 15: 74,626,179 L184P probably damaging Het
Muc2 C A 7: 141,754,140 N834K probably benign Het
Mycl A G 4: 123,000,256 D283G probably damaging Het
Myh6 T C 14: 54,953,293 N975S probably damaging Het
Myl12a A G 17: 70,996,302 probably benign Het
Mysm1 T C 4: 94,965,673 T230A probably benign Het
Naca A G 10: 128,047,803 K2099R probably null Het
Nbeal1 T G 1: 60,222,193 probably null Het
Nedd1 A G 10: 92,698,910 V246A probably benign Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Ninl G A 2: 150,959,881 R156* probably null Het
Obscn T A 11: 59,069,859 I3418F probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Pappa2 T C 1: 158,857,379 N730S probably damaging Het
Pcm1 G A 8: 41,293,678 D1305N probably damaging Het
Pcsk4 A T 10: 80,323,104 I485N probably damaging Het
Phldb2 T C 16: 45,825,874 R111G probably damaging Het
Prdm10 T C 9: 31,341,273 F385S probably damaging Het
Prkcsh C T 9: 22,011,738 P351L probably damaging Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Rad51c T C 11: 87,395,378 D251G probably damaging Het
Radil A G 5: 142,485,163 F1088L probably benign Het
Rere C A 4: 150,615,167 probably benign Het
Rnf167 T A 11: 70,650,135 C196S probably benign Het
Robo2 T A 16: 74,352,745 Y65F probably damaging Het
Scarf2 G A 16: 17,803,507 C319Y probably damaging Het
Sec24c A G 14: 20,693,712 D995G probably damaging Het
Selenbp1 T C 3: 94,943,900 L369S probably benign Het
Sgpl1 A T 10: 61,123,344 I53K possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc1a6 A T 10: 78,800,118 Y339F probably damaging Het
Smchd1 G T 17: 71,360,053 Y1781* probably null Het
Smg1 T C 7: 118,180,474 S1233G probably benign Het
Snap91 A T 9: 86,783,454 probably benign Het
Snx29 T A 16: 11,420,736 L112Q probably damaging Het
Sptbn5 T C 2: 120,059,141 probably benign Het
Srl A T 16: 4,492,358 H502Q possibly damaging Het
St5 C T 7: 109,557,033 G170D probably damaging Het
St8sia3 A G 18: 64,271,749 M366V probably benign Het
Stk19 A T 17: 34,822,509 probably benign Het
Syngap1 G A 17: 26,961,449 A611T probably benign Het
Tas2r113 A G 6: 132,893,707 T233A possibly damaging Het
Tbcc G A 17: 46,891,219 W177* probably null Het
Tcstv3 T A 13: 120,318,082 probably null Het
Trmt61a G A 12: 111,678,713 V28M possibly damaging Het
Ubap2l G A 3: 90,020,903 T553M probably damaging Het
Urb1 T C 16: 90,757,827 N1839S probably benign Het
Ush2a T C 1: 188,743,545 L2893P probably damaging Het
Usp24 G A 4: 106,360,162 V421M possibly damaging Het
Vmn1r43 T C 6: 89,869,910 E198G probably benign Het
Vps13d A C 4: 145,178,056 S130A probably damaging Het
Zfp426 T A 9: 20,471,014 I211F probably benign Het
Znfx1 T C 2: 167,038,569 probably null Het
Other mutations in Dnah8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dnah8 APN 17 30677176 missense probably benign 0.06
IGL00508:Dnah8 APN 17 30855930 missense probably damaging 1.00
IGL00547:Dnah8 APN 17 30815703 nonsense probably null
IGL00551:Dnah8 APN 17 30663478 nonsense probably null
IGL00732:Dnah8 APN 17 30656641 missense probably damaging 1.00
IGL00775:Dnah8 APN 17 30767906 nonsense probably null
IGL00840:Dnah8 APN 17 30790941 missense probably damaging 1.00
IGL00845:Dnah8 APN 17 30819276 critical splice donor site probably null
IGL00953:Dnah8 APN 17 30706457 nonsense probably null
IGL00976:Dnah8 APN 17 30851710 missense probably damaging 0.98
IGL01395:Dnah8 APN 17 30636005 missense probably benign 0.06
IGL01467:Dnah8 APN 17 30779916 missense probably damaging 1.00
IGL01469:Dnah8 APN 17 30683714 splice site probably benign
IGL01515:Dnah8 APN 17 30648485 missense probably benign
IGL01723:Dnah8 APN 17 30708471 missense probably damaging 1.00
IGL01837:Dnah8 APN 17 30751591 critical splice donor site probably null
IGL01921:Dnah8 APN 17 30736141 missense probably benign
IGL01958:Dnah8 APN 17 30855895 splice site probably benign
IGL01968:Dnah8 APN 17 30656598 nonsense probably null
IGL02093:Dnah8 APN 17 30717880 missense probably damaging 0.99
IGL02151:Dnah8 APN 17 30648417 missense possibly damaging 0.50
IGL02182:Dnah8 APN 17 30794763 missense possibly damaging 0.45
IGL02233:Dnah8 APN 17 30706513 critical splice donor site probably null
IGL02236:Dnah8 APN 17 30649773 nonsense probably null
IGL02259:Dnah8 APN 17 30759614 missense probably benign
IGL02263:Dnah8 APN 17 30729165 missense probably benign 0.00
IGL02303:Dnah8 APN 17 30713047 missense probably benign 0.03
IGL02341:Dnah8 APN 17 30747257 missense probably damaging 1.00
IGL02351:Dnah8 APN 17 30767811 missense probably damaging 1.00
IGL02358:Dnah8 APN 17 30767811 missense probably damaging 1.00
IGL02377:Dnah8 APN 17 30794796 missense probably damaging 0.98
IGL02390:Dnah8 APN 17 30830845 missense probably benign 0.01
IGL02392:Dnah8 APN 17 30818051 splice site probably benign
IGL02414:Dnah8 APN 17 30700413 missense probably benign
IGL02455:Dnah8 APN 17 30672334 missense probably damaging 0.99
IGL02817:Dnah8 APN 17 30668295 missense probably benign
IGL02831:Dnah8 APN 17 30712276 missense probably benign 0.23
IGL02863:Dnah8 APN 17 30769697 missense probably damaging 1.00
IGL02894:Dnah8 APN 17 30721110 nonsense probably null
IGL02954:Dnah8 APN 17 30704835 missense probably benign 0.30
IGL02964:Dnah8 APN 17 30746761 missense probably damaging 1.00
IGL03080:Dnah8 APN 17 30719006 missense probably benign 0.01
IGL03081:Dnah8 APN 17 30686373 splice site probably benign
IGL03086:Dnah8 APN 17 30742780 missense probably damaging 1.00
IGL03087:Dnah8 APN 17 30784144 missense probably benign
IGL03176:Dnah8 APN 17 30694037 missense probably benign
IGL03191:Dnah8 APN 17 30726830 missense probably damaging 0.99
IGL03210:Dnah8 APN 17 30815665 missense probably damaging 0.96
IGL03252:Dnah8 APN 17 30673920 splice site probably null
IGL03255:Dnah8 APN 17 30741381 missense probably damaging 1.00
IGL03288:Dnah8 APN 17 30672349 missense probably benign
IGL03348:Dnah8 APN 17 30746986 missense probably damaging 0.99
dynos UTSW 17 30715509 missense possibly damaging 0.84
joule UTSW 17 30713098 critical splice donor site probably null
FR4340:Dnah8 UTSW 17 30635463 small deletion probably benign
FR4737:Dnah8 UTSW 17 30635465 small deletion probably benign
FR4737:Dnah8 UTSW 17 30635477 small deletion probably benign
I2288:Dnah8 UTSW 17 30663454 missense probably benign
P0029:Dnah8 UTSW 17 30765720 missense probably damaging 1.00
PIT4812001:Dnah8 UTSW 17 30708445 missense probably benign 0.04
R0016:Dnah8 UTSW 17 30663316 missense probably benign
R0035:Dnah8 UTSW 17 30683621 splice site probably benign
R0035:Dnah8 UTSW 17 30683621 splice site probably benign
R0062:Dnah8 UTSW 17 30765711 missense probably damaging 1.00
R0062:Dnah8 UTSW 17 30765711 missense probably damaging 1.00
R0087:Dnah8 UTSW 17 30755119 missense probably damaging 1.00
R0090:Dnah8 UTSW 17 30784090 missense probably benign 0.20
R0119:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0164:Dnah8 UTSW 17 30748665 missense probably benign
R0164:Dnah8 UTSW 17 30748665 missense probably benign
R0184:Dnah8 UTSW 17 30683683 missense probably benign 0.04
R0240:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0240:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0265:Dnah8 UTSW 17 30690271 missense probably benign
R0268:Dnah8 UTSW 17 30769707 missense probably damaging 1.00
R0282:Dnah8 UTSW 17 30736156 missense probably damaging 1.00
R0299:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0334:Dnah8 UTSW 17 30871351 missense probably damaging 0.99
R0393:Dnah8 UTSW 17 30708390 missense probably benign 0.02
R0423:Dnah8 UTSW 17 30701981 missense probably benign
R0470:Dnah8 UTSW 17 30708540 splice site probably benign
R0477:Dnah8 UTSW 17 30755080 missense probably damaging 1.00
R0490:Dnah8 UTSW 17 30700419 missense probably benign
R0499:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0582:Dnah8 UTSW 17 30718961 missense probably benign 0.01
R0601:Dnah8 UTSW 17 30708358 missense probably benign 0.06
R0646:Dnah8 UTSW 17 30684173 missense probably damaging 0.97
R0665:Dnah8 UTSW 17 30736155 missense probably damaging 0.99
R0800:Dnah8 UTSW 17 30704662 missense probably benign
R0843:Dnah8 UTSW 17 30813095 missense probably damaging 1.00
R0940:Dnah8 UTSW 17 30803243 missense probably damaging 1.00
R0964:Dnah8 UTSW 17 30673920 splice site probably null
R1102:Dnah8 UTSW 17 30854764 intron probably null
R1137:Dnah8 UTSW 17 30855936 missense probably damaging 1.00
R1342:Dnah8 UTSW 17 30721000 missense probably damaging 0.99
R1375:Dnah8 UTSW 17 30737295 missense probably damaging 1.00
R1377:Dnah8 UTSW 17 30840622 nonsense probably null
R1464:Dnah8 UTSW 17 30695173 missense possibly damaging 0.81
R1464:Dnah8 UTSW 17 30695173 missense possibly damaging 0.81
R1470:Dnah8 UTSW 17 30747277 nonsense probably null
R1470:Dnah8 UTSW 17 30747277 nonsense probably null
R1497:Dnah8 UTSW 17 30752075 missense probably damaging 1.00
R1513:Dnah8 UTSW 17 30673888 missense probably benign
R1541:Dnah8 UTSW 17 30747247 missense probably damaging 1.00
R1563:Dnah8 UTSW 17 30635664 missense probably benign 0.07
R1634:Dnah8 UTSW 17 30713098 critical splice donor site probably null
R1670:Dnah8 UTSW 17 30725124 missense probably damaging 1.00
R1710:Dnah8 UTSW 17 30854940 missense probably damaging 1.00
R1743:Dnah8 UTSW 17 30769651 missense probably benign 0.28
R1761:Dnah8 UTSW 17 30779916 missense probably damaging 1.00
R1785:Dnah8 UTSW 17 30722937 missense probably damaging 0.98
R1804:Dnah8 UTSW 17 30708407 missense probably benign 0.00
R1808:Dnah8 UTSW 17 30684186 missense probably damaging 1.00
R1824:Dnah8 UTSW 17 30731180 missense possibly damaging 0.67
R1836:Dnah8 UTSW 17 30874927 missense possibly damaging 0.94
R1935:Dnah8 UTSW 17 30635505 missense unknown
R1935:Dnah8 UTSW 17 30726896 splice site probably benign
R1940:Dnah8 UTSW 17 30731207 missense probably damaging 1.00
R1946:Dnah8 UTSW 17 30712385 missense probably benign 0.00
R2025:Dnah8 UTSW 17 30731159 missense probably damaging 0.99
R2038:Dnah8 UTSW 17 30758281 missense probably damaging 1.00
R2042:Dnah8 UTSW 17 30635658 missense probably benign 0.01
R2148:Dnah8 UTSW 17 30737258 missense probably damaging 1.00
R2177:Dnah8 UTSW 17 30653393 missense probably benign
R2180:Dnah8 UTSW 17 30840647 missense probably benign 0.00
R2262:Dnah8 UTSW 17 30673835 missense probably damaging 1.00
R2263:Dnah8 UTSW 17 30673835 missense probably damaging 1.00
R2328:Dnah8 UTSW 17 30794744 missense probably damaging 1.00
R2357:Dnah8 UTSW 17 30771872 missense probably benign
R2357:Dnah8 UTSW 17 30874935 missense probably benign 0.00
R2360:Dnah8 UTSW 17 30677204 missense probably benign 0.22
R2496:Dnah8 UTSW 17 30851731 missense probably damaging 1.00
R2497:Dnah8 UTSW 17 30741365 nonsense probably null
R2509:Dnah8 UTSW 17 30775045 missense probably benign 0.02
R3114:Dnah8 UTSW 17 30833568 missense probably benign 0.04
R3708:Dnah8 UTSW 17 30739657 missense probably damaging 0.98
R3720:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3722:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3727:Dnah8 UTSW 17 30739648 nonsense probably null
R3747:Dnah8 UTSW 17 30784174 nonsense probably null
R3748:Dnah8 UTSW 17 30784174 nonsense probably null
R3749:Dnah8 UTSW 17 30784174 nonsense probably null
R3787:Dnah8 UTSW 17 30755041 missense probably damaging 1.00
R3790:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3804:Dnah8 UTSW 17 30670647 missense probably benign 0.00
R3857:Dnah8 UTSW 17 30663422 missense probably damaging 0.96
R3898:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3899:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3938:Dnah8 UTSW 17 30854937 missense probably damaging 1.00
R3943:Dnah8 UTSW 17 30694065 splice site probably benign
R4091:Dnah8 UTSW 17 30769839 missense probably damaging 1.00
R4291:Dnah8 UTSW 17 30748559 missense probably benign
R4326:Dnah8 UTSW 17 30752092 missense probably benign 0.04
R4346:Dnah8 UTSW 17 30725098 missense possibly damaging 0.92
R4429:Dnah8 UTSW 17 30752146 missense probably damaging 1.00
R4457:Dnah8 UTSW 17 30813151 missense probably benign
R4475:Dnah8 UTSW 17 30656985 missense probably benign 0.12
R4565:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4566:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4568:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4573:Dnah8 UTSW 17 30700406 missense probably benign 0.00
R4580:Dnah8 UTSW 17 30662052 missense probably benign 0.00
R4585:Dnah8 UTSW 17 30751567 missense probably benign 0.01
R4611:Dnah8 UTSW 17 30684237 missense probably damaging 1.00
R4720:Dnah8 UTSW 17 30683634 missense probably benign 0.08
R4721:Dnah8 UTSW 17 30725166 missense probably damaging 1.00
R4727:Dnah8 UTSW 17 30851747 missense probably damaging 1.00
R4731:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4732:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4733:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4814:Dnah8 UTSW 17 30767924 missense probably damaging 1.00
R4892:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4894:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4900:Dnah8 UTSW 17 30746975 missense probably damaging 1.00
R4901:Dnah8 UTSW 17 30840714 critical splice donor site probably null
R4913:Dnah8 UTSW 17 30819139 missense probably damaging 0.99
R4931:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4932:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4933:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4942:Dnah8 UTSW 17 30729142 missense probably benign
R4969:Dnah8 UTSW 17 30723014 missense probably damaging 1.00
R4975:Dnah8 UTSW 17 30656985 missense probably benign 0.12
R4977:Dnah8 UTSW 17 30663301 missense probably benign 0.00
R5001:Dnah8 UTSW 17 30787185 missense probably damaging 1.00
R5011:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5013:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5014:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5024:Dnah8 UTSW 17 30736096 missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30739757 critical splice donor site probably null
R5075:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5075:Dnah8 UTSW 17 30800531 missense probably damaging 1.00
R5112:Dnah8 UTSW 17 30731038 missense probably benign 0.02
R5121:Dnah8 UTSW 17 30810353 missense probably benign 0.14
R5138:Dnah8 UTSW 17 30765597 missense probably damaging 0.99
R5151:Dnah8 UTSW 17 30712295 missense probably benign 0.06
R5191:Dnah8 UTSW 17 30746765 missense probably damaging 1.00
R5238:Dnah8 UTSW 17 30790917 missense probably damaging 1.00
R5260:Dnah8 UTSW 17 30700419 missense probably benign
R5358:Dnah8 UTSW 17 30746954 missense probably damaging 1.00
R5403:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5404:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5482:Dnah8 UTSW 17 30800547 missense probably damaging 0.96
R5489:Dnah8 UTSW 17 30790956 missense probably damaging 1.00
R5513:Dnah8 UTSW 17 30752916 missense probably damaging 0.99
R5635:Dnah8 UTSW 17 30706386 missense probably benign 0.00
R5640:Dnah8 UTSW 17 30803108 missense probably damaging 1.00
R5649:Dnah8 UTSW 17 30800587 missense probably benign 0.13
R5662:Dnah8 UTSW 17 30737333 missense probably damaging 1.00
R5673:Dnah8 UTSW 17 30803261 missense probably damaging 1.00
R5677:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5699:Dnah8 UTSW 17 30810324 missense probably benign 0.22
R5737:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5738:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5739:Dnah8 UTSW 17 30719007 missense probably benign 0.00
R5766:Dnah8 UTSW 17 30690261 missense probably benign 0.01
R5790:Dnah8 UTSW 17 30875004 missense probably damaging 0.98
R5848:Dnah8 UTSW 17 30728191 missense possibly damaging 0.69
R5854:Dnah8 UTSW 17 30794763 missense possibly damaging 0.45
R5885:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5886:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5887:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5899:Dnah8 UTSW 17 30656685 missense probably benign 0.32
R5979:Dnah8 UTSW 17 30815664 nonsense probably null
R5986:Dnah8 UTSW 17 30851630 missense possibly damaging 0.83
R5999:Dnah8 UTSW 17 30663305 missense probably benign 0.32
R6042:Dnah8 UTSW 17 30747265 missense probably damaging 1.00
R6175:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6181:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6237:Dnah8 UTSW 17 30747854 nonsense probably null
R6239:Dnah8 UTSW 17 30810359 missense probably damaging 0.99
R6337:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6365:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6416:Dnah8 UTSW 17 30765635 missense probably benign
R6443:Dnah8 UTSW 17 30771885 missense probably benign 0.10
R6478:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6479:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6480:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6481:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6533:Dnah8 UTSW 17 30746990 missense probably damaging 1.00
R6606:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6608:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6610:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6675:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6723:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6724:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6754:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6755:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6759:Dnah8 UTSW 17 30663292 splice site probably null
R6765:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6766:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6778:Dnah8 UTSW 17 30635666 missense probably benign 0.00
R6781:Dnah8 UTSW 17 30765724 frame shift probably null
R6788:Dnah8 UTSW 17 30648465 missense probably benign 0.14
R6814:Dnah8 UTSW 17 30762679 missense probably damaging 1.00
R6825:Dnah8 UTSW 17 30741173 missense probably damaging 1.00
R6838:Dnah8 UTSW 17 30710551 missense probably damaging 1.00
R6872:Dnah8 UTSW 17 30762679 missense probably damaging 1.00
R6877:Dnah8 UTSW 17 30746959 missense probably damaging 1.00
R6944:Dnah8 UTSW 17 30794659 missense probably benign 0.09
R6982:Dnah8 UTSW 17 30767925 missense probably benign 0.03
R6984:Dnah8 UTSW 17 30739738 missense probably damaging 1.00
R6987:Dnah8 UTSW 17 30662091 missense possibly damaging 0.95
R6988:Dnah8 UTSW 17 30643275 missense probably damaging 1.00
R7099:Dnah8 UTSW 17 30704724 missense possibly damaging 0.93
R7106:Dnah8 UTSW 17 30741178 missense probably damaging 1.00
R7112:Dnah8 UTSW 17 30871392 missense possibly damaging 0.79
R7146:Dnah8 UTSW 17 30644617 missense probably benign 0.01
R7146:Dnah8 UTSW 17 30769644 missense possibly damaging 0.90
X0001:Dnah8 UTSW 17 30748680 missense probably damaging 1.00
X0013:Dnah8 UTSW 17 30819186 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GACACTCATCAGGCTATGTCTTG -3'
(R):5'- TAGCCGCACTTACCGTAGTC -3'

Sequencing Primer
(F):5'- ATTTCTGTTTTCTTTTCTCTTCCCC -3'
(R):5'- TACATAGTCTGCTGGGAG -3'
Posted On2016-02-04