Incidental Mutation 'R4798:Adamts10'
ID369269
Institutional Source Beutler Lab
Gene Symbol Adamts10
Ensembl Gene ENSMUSG00000024299
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10
SynonymsZnMP
MMRRC Submission 042422-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock #R4798 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33524204-33553782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33528752 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 54 (L54Q)
Ref Sequence ENSEMBL: ENSMUSP00000133434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087623] [ENSMUST00000172922] [ENSMUST00000173013] [ENSMUST00000173030] [ENSMUST00000173241] [ENSMUST00000173931]
Predicted Effect probably damaging
Transcript: ENSMUST00000087623
AA Change: L54Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084905
Gene: ENSMUSG00000024299
AA Change: L54Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 180 1.3e-33 PFAM
Pfam:Reprolysin_5 237 432 5e-15 PFAM
Pfam:Reprolysin_4 237 448 5e-11 PFAM
Pfam:Reprolysin 239 457 1.6e-25 PFAM
Pfam:Reprolysin_2 257 447 1.2e-13 PFAM
Pfam:Reprolysin_3 261 403 5.7e-13 PFAM
TSP1 550 602 7.21e-11 SMART
Pfam:ADAM_spacer1 706 818 1.3e-27 PFAM
TSP1 828 885 4.73e-6 SMART
TSP1 887 940 4.35e-2 SMART
TSP1 948 1003 2.66e-2 SMART
TSP1 1006 1058 9.98e-5 SMART
Pfam:PLAC 1070 1102 8.4e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172922
AA Change: L54Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133891
Gene: ENSMUSG00000024299
AA Change: L54Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 1.1e-30 PFAM
SCOP:d1bkca_ 238 271 4e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173013
AA Change: L54Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134181
Gene: ENSMUSG00000024299
AA Change: L54Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173030
AA Change: L54Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134549
Gene: ENSMUSG00000024299
AA Change: L54Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173241
AA Change: L54Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134298
Gene: ENSMUSG00000024299
AA Change: L54Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173813
Predicted Effect probably damaging
Transcript: ENSMUST00000173931
AA Change: L54Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133434
Gene: ENSMUSG00000024299
AA Change: L54Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174170
Predicted Effect probably benign
Transcript: ENSMUST00000174348
SMART Domains Protein: ENSMUSP00000133856
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
Pfam:Reprolysin_5 23 220 2.6e-16 PFAM
Pfam:Reprolysin_4 23 235 2.6e-12 PFAM
Pfam:Reprolysin 25 243 1e-26 PFAM
Pfam:Reprolysin_2 43 233 7.1e-15 PFAM
Pfam:Reprolysin_3 47 189 4.7e-14 PFAM
Meta Mutation Damage Score 0.286 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (111/114)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate a functional, zinc-dependent metallopeptidase enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,624,965 D617E probably benign Het
2210408I21Rik T C 13: 77,323,724 W1083R possibly damaging Het
Ankrd24 A C 10: 81,643,315 probably benign Het
Atg2b A G 12: 105,652,629 S813P probably benign Het
Atp13a3 T A 16: 30,341,240 I716F probably damaging Het
Atp6v1c1 T A 15: 38,689,176 W294R probably damaging Het
Atrnl1 G T 19: 58,042,361 A1312S probably benign Het
B230359F08Rik T A 14: 53,795,951 C106S probably damaging Het
Bcl2 A T 1: 106,712,608 H91Q possibly damaging Het
Cacna1c G A 6: 118,630,302 Q1214* probably null Het
Cacna1g C A 11: 94,433,847 G1183W probably damaging Het
Capsl A T 15: 9,461,742 M75L probably benign Het
Ccdc122 T G 14: 77,111,607 probably benign Het
Ccdc57 T G 11: 120,881,857 R645S possibly damaging Het
Cdh8 T A 8: 99,024,926 R720* probably null Het
Cenpx T G 11: 120,711,784 probably benign Het
Clic3 T C 2: 25,458,182 S114P probably damaging Het
Crtac1 A T 19: 42,323,801 W158R possibly damaging Het
Dhrs11 T A 11: 84,828,800 Q33L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpp9 G T 17: 56,191,016 Q647K probably damaging Het
Egf C T 3: 129,716,678 G64D probably damaging Het
Eif2b4 C T 5: 31,189,520 probably benign Het
Epas1 A G 17: 86,805,839 N151S probably benign Het
Fastkd1 A T 2: 69,691,307 I707K probably benign Het
Fbln2 A G 6: 91,269,186 T1005A probably benign Het
Fgfrl1 T A 5: 108,703,497 Y93* probably null Het
Fktn A G 4: 53,744,637 T306A probably benign Het
Gabbr2 T G 4: 46,991,139 Y96S possibly damaging Het
Gm16332 A T 1: 139,891,658 noncoding transcript Het
Gm5145 G T 17: 20,570,548 V63F probably damaging Het
Gm9970 G T 5: 31,241,085 probably benign Het
Gpr158 A G 2: 21,783,182 T545A probably damaging Het
Heatr1 G A 13: 12,412,048 E685K probably benign Het
Herc6 A T 6: 57,604,166 I284F probably damaging Het
Hook1 C G 4: 96,002,557 A301G possibly damaging Het
Hpcal4 T A 4: 123,190,698 M140K possibly damaging Het
Il11ra1 T C 4: 41,766,096 probably benign Het
Ildr1 A T 16: 36,722,555 H439L possibly damaging Het
Itga11 A G 9: 62,776,727 probably null Het
Jag2 A T 12: 112,916,632 D337E probably benign Het
Krt82 C T 15: 101,550,488 R39Q probably benign Het
L3mbtl4 T A 17: 68,359,480 M1K probably null Het
Lrrc32 T G 7: 98,499,017 F335V probably damaging Het
Lurap1l T A 4: 80,911,413 V20E probably damaging Het
Lyar T A 5: 38,227,886 V90D possibly damaging Het
Man2c1 C T 9: 57,141,185 R778* probably null Het
Mapk6 A G 9: 75,388,432 F595L probably benign Het
Mccc1 A G 3: 35,985,001 I281T probably damaging Het
Mep1b T C 18: 21,093,254 V391A probably damaging Het
Mier1 G A 4: 103,130,998 D40N probably damaging Het
Mkx T C 18: 7,002,432 H38R probably benign Het
Mroh4 A G 15: 74,626,179 L184P probably damaging Het
Muc2 C A 7: 141,754,140 N834K probably benign Het
Mycl A G 4: 123,000,256 D283G probably damaging Het
Myh6 T C 14: 54,953,293 N975S probably damaging Het
Myl12a A G 17: 70,996,302 probably benign Het
Mysm1 T C 4: 94,965,673 T230A probably benign Het
Naca A G 10: 128,047,803 K2099R probably null Het
Nbeal1 T G 1: 60,222,193 probably null Het
Nedd1 A G 10: 92,698,910 V246A probably benign Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Ninl G A 2: 150,959,881 R156* probably null Het
Obscn T A 11: 59,069,859 I3418F probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Pappa2 T C 1: 158,857,379 N730S probably damaging Het
Pcm1 G A 8: 41,293,678 D1305N probably damaging Het
Pcsk4 A T 10: 80,323,104 I485N probably damaging Het
Phldb2 T C 16: 45,825,874 R111G probably damaging Het
Prdm10 T C 9: 31,341,273 F385S probably damaging Het
Prkcsh C T 9: 22,011,738 P351L probably damaging Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Rad51c T C 11: 87,395,378 D251G probably damaging Het
Radil A G 5: 142,485,163 F1088L probably benign Het
Rere C A 4: 150,615,167 probably benign Het
Rnf167 T A 11: 70,650,135 C196S probably benign Het
Robo2 T A 16: 74,352,745 Y65F probably damaging Het
Scarf2 G A 16: 17,803,507 C319Y probably damaging Het
Sec24c A G 14: 20,693,712 D995G probably damaging Het
Selenbp1 T C 3: 94,943,900 L369S probably benign Het
Sgpl1 A T 10: 61,123,344 I53K possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc1a6 A T 10: 78,800,118 Y339F probably damaging Het
Smchd1 G T 17: 71,360,053 Y1781* probably null Het
Smg1 T C 7: 118,180,474 S1233G probably benign Het
Snap91 A T 9: 86,783,454 probably benign Het
Snx29 T A 16: 11,420,736 L112Q probably damaging Het
Sptbn5 T C 2: 120,059,141 probably benign Het
Srl A T 16: 4,492,358 H502Q possibly damaging Het
St5 C T 7: 109,557,033 G170D probably damaging Het
St8sia3 A G 18: 64,271,749 M366V probably benign Het
Stk19 A T 17: 34,822,509 probably benign Het
Syngap1 G A 17: 26,961,449 A611T probably benign Het
Tas2r113 A G 6: 132,893,707 T233A possibly damaging Het
Tbcc G A 17: 46,891,219 W177* probably null Het
Tcstv3 T A 13: 120,318,082 probably null Het
Trmt61a G A 12: 111,678,713 V28M possibly damaging Het
Ubap2l G A 3: 90,020,903 T553M probably damaging Het
Urb1 T C 16: 90,757,827 N1839S probably benign Het
Ush2a T C 1: 188,743,545 L2893P probably damaging Het
Usp24 G A 4: 106,360,162 V421M possibly damaging Het
Vmn1r43 T C 6: 89,869,910 E198G probably benign Het
Vps13d A C 4: 145,178,056 S130A probably damaging Het
Zfp426 T A 9: 20,471,014 I211F probably benign Het
Znfx1 T C 2: 167,038,569 probably null Het
Other mutations in Adamts10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:Adamts10 APN 17 33543231 missense probably benign 0.24
IGL01865:Adamts10 APN 17 33553166 missense probably damaging 0.99
IGL02391:Adamts10 APN 17 33528811 missense probably benign 0.00
IGL02711:Adamts10 APN 17 33538272 missense probably damaging 0.99
R0122:Adamts10 UTSW 17 33528480 unclassified probably benign
R0207:Adamts10 UTSW 17 33545390 missense possibly damaging 0.64
R0481:Adamts10 UTSW 17 33549373 nonsense probably null
R0508:Adamts10 UTSW 17 33543718 missense probably damaging 1.00
R0558:Adamts10 UTSW 17 33550609 missense probably benign 0.04
R0746:Adamts10 UTSW 17 33549547 nonsense probably null
R1027:Adamts10 UTSW 17 33543763 missense probably benign 0.44
R1449:Adamts10 UTSW 17 33545639 missense probably damaging 0.96
R1471:Adamts10 UTSW 17 33553138 missense probably damaging 1.00
R1522:Adamts10 UTSW 17 33537319 missense probably benign 0.40
R1631:Adamts10 UTSW 17 33537342 missense probably benign 0.25
R1863:Adamts10 UTSW 17 33551432 critical splice donor site probably null
R1913:Adamts10 UTSW 17 33549555 missense probably benign 0.00
R2091:Adamts10 UTSW 17 33551192 critical splice donor site probably null
R2377:Adamts10 UTSW 17 33528892 missense probably damaging 1.00
R3743:Adamts10 UTSW 17 33528712 missense probably damaging 1.00
R4042:Adamts10 UTSW 17 33549540 missense possibly damaging 0.69
R4646:Adamts10 UTSW 17 33545555 missense probably damaging 1.00
R4654:Adamts10 UTSW 17 33537330 missense possibly damaging 0.89
R4695:Adamts10 UTSW 17 33531739 missense possibly damaging 0.95
R4721:Adamts10 UTSW 17 33545537 splice site probably null
R4896:Adamts10 UTSW 17 33528896 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATGGCTGGGACTGTATAGGC -3'
(R):5'- AGAATCCTCAGCTCACCAGG -3'

Sequencing Primer
(F):5'- CTGTATAGGCTGAATAGTCACTAGG -3'
(R):5'- ACATGGGAGCTACCAGCCTG -3'
Posted On2016-02-04