Incidental Mutation 'R4798:Prrc2a'
ID369271
Institutional Source Beutler Lab
Gene Symbol Prrc2a
Ensembl Gene ENSMUSG00000024393
Gene Nameproline-rich coiled-coil 2A
SynonymsD17H6S51E, G2, 3110039B05Rik, Bat-2, Bat2, Wbp12
MMRRC Submission 042422-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.604) question?
Stock #R4798 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35149076-35164897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35150042 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 2006 (P2006L)
Ref Sequence ENSEMBL: ENSMUSP00000025253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025250] [ENSMUST00000025253] [ENSMUST00000166426] [ENSMUST00000172571] [ENSMUST00000173550] [ENSMUST00000174281] [ENSMUST00000174805]
Predicted Effect probably benign
Transcript: ENSMUST00000025250
SMART Domains Protein: ENSMUSP00000025250
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 239 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
Pfam:DUF3538 277 393 1.7e-44 PFAM
low complexity region 427 438 N/A INTRINSIC
low complexity region 557 625 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
low complexity region 673 721 N/A INTRINSIC
low complexity region 725 747 N/A INTRINSIC
low complexity region 765 780 N/A INTRINSIC
low complexity region 798 808 N/A INTRINSIC
low complexity region 1029 1042 N/A INTRINSIC
low complexity region 1088 1098 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000025253
AA Change: P2006L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025253
Gene: ENSMUSG00000024393
AA Change: P2006L

DomainStartEndE-ValueType
Pfam:BAT2_N 1 189 1.2e-70 PFAM
low complexity region 243 276 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
low complexity region 396 413 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
coiled coil region 455 494 N/A INTRINSIC
low complexity region 504 523 N/A INTRINSIC
low complexity region 527 566 N/A INTRINSIC
low complexity region 593 618 N/A INTRINSIC
low complexity region 643 684 N/A INTRINSIC
low complexity region 687 709 N/A INTRINSIC
low complexity region 711 717 N/A INTRINSIC
low complexity region 755 768 N/A INTRINSIC
low complexity region 826 833 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
low complexity region 882 894 N/A INTRINSIC
low complexity region 902 924 N/A INTRINSIC
low complexity region 944 966 N/A INTRINSIC
low complexity region 1032 1070 N/A INTRINSIC
low complexity region 1129 1149 N/A INTRINSIC
low complexity region 1162 1179 N/A INTRINSIC
low complexity region 1190 1211 N/A INTRINSIC
low complexity region 1234 1242 N/A INTRINSIC
low complexity region 1285 1300 N/A INTRINSIC
low complexity region 1346 1360 N/A INTRINSIC
low complexity region 1394 1424 N/A INTRINSIC
low complexity region 1430 1456 N/A INTRINSIC
low complexity region 1488 1511 N/A INTRINSIC
low complexity region 1553 1565 N/A INTRINSIC
low complexity region 1693 1713 N/A INTRINSIC
internal_repeat_1 1810 1860 5.56e-5 PROSPERO
low complexity region 1879 1895 N/A INTRINSIC
internal_repeat_1 1924 1983 5.56e-5 PROSPERO
low complexity region 1995 2017 N/A INTRINSIC
low complexity region 2019 2041 N/A INTRINSIC
low complexity region 2070 2086 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166426
SMART Domains Protein: ENSMUSP00000129324
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Pfam:DUF3538 259 375 3.7e-53 PFAM
low complexity region 409 420 N/A INTRINSIC
low complexity region 539 607 N/A INTRINSIC
low complexity region 614 630 N/A INTRINSIC
low complexity region 655 703 N/A INTRINSIC
low complexity region 707 729 N/A INTRINSIC
low complexity region 747 762 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1070 1080 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172571
SMART Domains Protein: ENSMUSP00000134175
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 252 N/A INTRINSIC
Pfam:DUF3538 254 370 3.5e-53 PFAM
low complexity region 404 415 N/A INTRINSIC
low complexity region 534 602 N/A INTRINSIC
low complexity region 609 625 N/A INTRINSIC
low complexity region 650 698 N/A INTRINSIC
low complexity region 702 724 N/A INTRINSIC
low complexity region 742 757 N/A INTRINSIC
low complexity region 775 785 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172899
Predicted Effect probably benign
Transcript: ENSMUST00000172993
Predicted Effect probably benign
Transcript: ENSMUST00000173550
SMART Domains Protein: ENSMUSP00000134628
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Pfam:DUF3538 259 375 3.7e-53 PFAM
low complexity region 409 420 N/A INTRINSIC
low complexity region 496 511 N/A INTRINSIC
low complexity region 574 642 N/A INTRINSIC
low complexity region 649 665 N/A INTRINSIC
low complexity region 690 738 N/A INTRINSIC
low complexity region 742 764 N/A INTRINSIC
low complexity region 782 797 N/A INTRINSIC
low complexity region 815 825 N/A INTRINSIC
low complexity region 1046 1059 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173558
Predicted Effect probably benign
Transcript: ENSMUST00000174281
SMART Domains Protein: ENSMUSP00000134425
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 239 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
Pfam:DUF3538 277 393 3.6e-53 PFAM
low complexity region 427 438 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
low complexity region 592 660 N/A INTRINSIC
low complexity region 667 683 N/A INTRINSIC
low complexity region 708 756 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 1064 1077 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174386
Predicted Effect unknown
Transcript: ENSMUST00000174805
AA Change: P1950L
SMART Domains Protein: ENSMUSP00000133550
Gene: ENSMUSG00000024393
AA Change: P1950L

DomainStartEndE-ValueType
Pfam:BAT2_N 1 137 6.6e-53 PFAM
low complexity region 188 221 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
coiled coil region 400 439 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 472 511 N/A INTRINSIC
low complexity region 538 563 N/A INTRINSIC
low complexity region 588 629 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 656 662 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
low complexity region 771 778 N/A INTRINSIC
low complexity region 806 816 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 847 869 N/A INTRINSIC
low complexity region 889 911 N/A INTRINSIC
low complexity region 977 1015 N/A INTRINSIC
low complexity region 1074 1094 N/A INTRINSIC
low complexity region 1107 1124 N/A INTRINSIC
low complexity region 1135 1156 N/A INTRINSIC
low complexity region 1179 1187 N/A INTRINSIC
low complexity region 1230 1245 N/A INTRINSIC
low complexity region 1291 1305 N/A INTRINSIC
low complexity region 1339 1369 N/A INTRINSIC
low complexity region 1375 1401 N/A INTRINSIC
low complexity region 1433 1456 N/A INTRINSIC
low complexity region 1498 1510 N/A INTRINSIC
low complexity region 1638 1658 N/A INTRINSIC
internal_repeat_1 1755 1804 3.99e-5 PROSPERO
low complexity region 1823 1839 N/A INTRINSIC
internal_repeat_1 1868 1927 3.99e-5 PROSPERO
low complexity region 1939 1961 N/A INTRINSIC
low complexity region 1963 1985 N/A INTRINSIC
low complexity region 2014 2030 N/A INTRINSIC
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (111/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for TNF alpha and TNF beta. These genes are all within the human major histocompatibility complex class III region. This gene has microsatellite repeats which are associated with the age-at-onset of insulin-dependent diabetes mellitus (IDDM) and possibly thought to be involved with the inflammatory process of pancreatic beta-cell destruction during the development of IDDM. This gene is also a candidate gene for the development of rheumatoid arthritis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,624,965 D617E probably benign Het
2210408I21Rik T C 13: 77,323,724 W1083R possibly damaging Het
Adamts10 T A 17: 33,528,752 L54Q probably damaging Het
Ankrd24 A C 10: 81,643,315 probably benign Het
Atg2b A G 12: 105,652,629 S813P probably benign Het
Atp13a3 T A 16: 30,341,240 I716F probably damaging Het
Atp6v1c1 T A 15: 38,689,176 W294R probably damaging Het
Atrnl1 G T 19: 58,042,361 A1312S probably benign Het
B230359F08Rik T A 14: 53,795,951 C106S probably damaging Het
Bcl2 A T 1: 106,712,608 H91Q possibly damaging Het
Cacna1c G A 6: 118,630,302 Q1214* probably null Het
Cacna1g C A 11: 94,433,847 G1183W probably damaging Het
Capsl A T 15: 9,461,742 M75L probably benign Het
Ccdc122 T G 14: 77,111,607 probably benign Het
Ccdc57 T G 11: 120,881,857 R645S possibly damaging Het
Cdh8 T A 8: 99,024,926 R720* probably null Het
Cenpx T G 11: 120,711,784 probably benign Het
Clic3 T C 2: 25,458,182 S114P probably damaging Het
Crtac1 A T 19: 42,323,801 W158R possibly damaging Het
Dhrs11 T A 11: 84,828,800 Q33L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpp9 G T 17: 56,191,016 Q647K probably damaging Het
Egf C T 3: 129,716,678 G64D probably damaging Het
Eif2b4 C T 5: 31,189,520 probably benign Het
Epas1 A G 17: 86,805,839 N151S probably benign Het
Fastkd1 A T 2: 69,691,307 I707K probably benign Het
Fbln2 A G 6: 91,269,186 T1005A probably benign Het
Fgfrl1 T A 5: 108,703,497 Y93* probably null Het
Fktn A G 4: 53,744,637 T306A probably benign Het
Gabbr2 T G 4: 46,991,139 Y96S possibly damaging Het
Gm16332 A T 1: 139,891,658 noncoding transcript Het
Gm5145 G T 17: 20,570,548 V63F probably damaging Het
Gm9970 G T 5: 31,241,085 probably benign Het
Gpr158 A G 2: 21,783,182 T545A probably damaging Het
Heatr1 G A 13: 12,412,048 E685K probably benign Het
Herc6 A T 6: 57,604,166 I284F probably damaging Het
Hook1 C G 4: 96,002,557 A301G possibly damaging Het
Hpcal4 T A 4: 123,190,698 M140K possibly damaging Het
Il11ra1 T C 4: 41,766,096 probably benign Het
Ildr1 A T 16: 36,722,555 H439L possibly damaging Het
Itga11 A G 9: 62,776,727 probably null Het
Jag2 A T 12: 112,916,632 D337E probably benign Het
Krt82 C T 15: 101,550,488 R39Q probably benign Het
L3mbtl4 T A 17: 68,359,480 M1K probably null Het
Lrrc32 T G 7: 98,499,017 F335V probably damaging Het
Lurap1l T A 4: 80,911,413 V20E probably damaging Het
Lyar T A 5: 38,227,886 V90D possibly damaging Het
Man2c1 C T 9: 57,141,185 R778* probably null Het
Mapk6 A G 9: 75,388,432 F595L probably benign Het
Mccc1 A G 3: 35,985,001 I281T probably damaging Het
Mep1b T C 18: 21,093,254 V391A probably damaging Het
Mier1 G A 4: 103,130,998 D40N probably damaging Het
Mkx T C 18: 7,002,432 H38R probably benign Het
Mroh4 A G 15: 74,626,179 L184P probably damaging Het
Muc2 C A 7: 141,754,140 N834K probably benign Het
Mycl A G 4: 123,000,256 D283G probably damaging Het
Myh6 T C 14: 54,953,293 N975S probably damaging Het
Myl12a A G 17: 70,996,302 probably benign Het
Mysm1 T C 4: 94,965,673 T230A probably benign Het
Naca A G 10: 128,047,803 K2099R probably null Het
Nbeal1 T G 1: 60,222,193 probably null Het
Nedd1 A G 10: 92,698,910 V246A probably benign Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Ninl G A 2: 150,959,881 R156* probably null Het
Obscn T A 11: 59,069,859 I3418F probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Pappa2 T C 1: 158,857,379 N730S probably damaging Het
Pcm1 G A 8: 41,293,678 D1305N probably damaging Het
Pcsk4 A T 10: 80,323,104 I485N probably damaging Het
Phldb2 T C 16: 45,825,874 R111G probably damaging Het
Prdm10 T C 9: 31,341,273 F385S probably damaging Het
Prkcsh C T 9: 22,011,738 P351L probably damaging Het
Rad51c T C 11: 87,395,378 D251G probably damaging Het
Radil A G 5: 142,485,163 F1088L probably benign Het
Rere C A 4: 150,615,167 probably benign Het
Rnf167 T A 11: 70,650,135 C196S probably benign Het
Robo2 T A 16: 74,352,745 Y65F probably damaging Het
Scarf2 G A 16: 17,803,507 C319Y probably damaging Het
Sec24c A G 14: 20,693,712 D995G probably damaging Het
Selenbp1 T C 3: 94,943,900 L369S probably benign Het
Sgpl1 A T 10: 61,123,344 I53K possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc1a6 A T 10: 78,800,118 Y339F probably damaging Het
Smchd1 G T 17: 71,360,053 Y1781* probably null Het
Smg1 T C 7: 118,180,474 S1233G probably benign Het
Snap91 A T 9: 86,783,454 probably benign Het
Snx29 T A 16: 11,420,736 L112Q probably damaging Het
Sptbn5 T C 2: 120,059,141 probably benign Het
Srl A T 16: 4,492,358 H502Q possibly damaging Het
St5 C T 7: 109,557,033 G170D probably damaging Het
St8sia3 A G 18: 64,271,749 M366V probably benign Het
Stk19 A T 17: 34,822,509 probably benign Het
Syngap1 G A 17: 26,961,449 A611T probably benign Het
Tas2r113 A G 6: 132,893,707 T233A possibly damaging Het
Tbcc G A 17: 46,891,219 W177* probably null Het
Tcstv3 T A 13: 120,318,082 probably null Het
Trmt61a G A 12: 111,678,713 V28M possibly damaging Het
Ubap2l G A 3: 90,020,903 T553M probably damaging Het
Urb1 T C 16: 90,757,827 N1839S probably benign Het
Ush2a T C 1: 188,743,545 L2893P probably damaging Het
Usp24 G A 4: 106,360,162 V421M possibly damaging Het
Vmn1r43 T C 6: 89,869,910 E198G probably benign Het
Vps13d A C 4: 145,178,056 S130A probably damaging Het
Zfp426 T A 9: 20,471,014 I211F probably benign Het
Znfx1 T C 2: 167,038,569 probably null Het
Other mutations in Prrc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Prrc2a APN 17 35154983 missense probably damaging 0.99
IGL01083:Prrc2a APN 17 35156201 missense possibly damaging 0.93
IGL01394:Prrc2a APN 17 35153104 missense probably benign 0.00
IGL01618:Prrc2a APN 17 35149553 missense probably damaging 1.00
IGL01700:Prrc2a APN 17 35150667 missense possibly damaging 0.93
IGL01937:Prrc2a APN 17 35155591 missense possibly damaging 0.63
IGL02407:Prrc2a APN 17 35160504 missense unknown
IGL02683:Prrc2a APN 17 35155993 missense probably benign 0.00
R0145:Prrc2a UTSW 17 35155820 missense probably benign
R0309:Prrc2a UTSW 17 35150915 splice site probably benign
R0441:Prrc2a UTSW 17 35149688 splice site probably benign
R0617:Prrc2a UTSW 17 35153560 missense probably damaging 1.00
R0645:Prrc2a UTSW 17 35156332 missense probably damaging 0.99
R1351:Prrc2a UTSW 17 35157887 missense possibly damaging 0.86
R1432:Prrc2a UTSW 17 35153912 splice site probably benign
R1490:Prrc2a UTSW 17 35153254 missense probably benign
R1643:Prrc2a UTSW 17 35156954 missense probably damaging 0.99
R1734:Prrc2a UTSW 17 35150707 missense possibly damaging 0.93
R1869:Prrc2a UTSW 17 35153308 missense possibly damaging 0.93
R1937:Prrc2a UTSW 17 35157908 missense probably damaging 0.99
R1995:Prrc2a UTSW 17 35157429 missense probably damaging 0.98
R2257:Prrc2a UTSW 17 35161068 missense unknown
R2270:Prrc2a UTSW 17 35149536 missense possibly damaging 0.91
R3940:Prrc2a UTSW 17 35157498 missense possibly damaging 0.86
R3973:Prrc2a UTSW 17 35157932 missense probably damaging 0.99
R4569:Prrc2a UTSW 17 35158497 missense unknown
R4655:Prrc2a UTSW 17 35155614 missense probably benign 0.00
R4792:Prrc2a UTSW 17 35156487 missense probably damaging 0.96
R4797:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R4799:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R5004:Prrc2a UTSW 17 35149998 missense probably benign 0.11
R5129:Prrc2a UTSW 17 35160178 missense unknown
R5155:Prrc2a UTSW 17 35160091 splice site probably null
R5210:Prrc2a UTSW 17 35153620 missense probably damaging 0.99
R5308:Prrc2a UTSW 17 35161047 missense unknown
R5474:Prrc2a UTSW 17 35159213 missense unknown
R5775:Prrc2a UTSW 17 35158487 missense unknown
R5934:Prrc2a UTSW 17 35150084 missense probably damaging 0.98
R6057:Prrc2a UTSW 17 35152740 missense probably benign 0.00
R6291:Prrc2a UTSW 17 35154933 missense probably damaging 0.99
R6535:Prrc2a UTSW 17 35162265 missense unknown
R6622:Prrc2a UTSW 17 35155420 missense probably damaging 0.98
R6887:Prrc2a UTSW 17 35155675 missense probably damaging 0.99
R6971:Prrc2a UTSW 17 35159501 intron probably null
R7026:Prrc2a UTSW 17 35161827 missense unknown
R7059:Prrc2a UTSW 17 35157388 missense probably damaging 0.99
X0011:Prrc2a UTSW 17 35155898 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTTGCTGTCTGAACCATTTACC -3'
(R):5'- AGAGTGGCTTCCTTCCTTCG -3'

Sequencing Primer
(F):5'- ATACCTTGCCATCCTTCAAAAACTTG -3'
(R):5'- TGCTCAGCAGGTATCTTTGATC -3'
Posted On2016-02-04