Incidental Mutation 'R0419:Neo1'
ID36929
Institutional Source Beutler Lab
Gene Symbol Neo1
Ensembl Gene ENSMUSG00000032340
Gene Nameneogenin
Synonyms2610028H22Rik, D930014N22Rik, Igdcc2
MMRRC Submission 038621-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0419 (G1)
Quality Score157
Status Validated
Chromosome9
Chromosomal Location58874687-59036441 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 58990180 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068664] [ENSMUST00000214547]
Predicted Effect probably benign
Transcript: ENSMUST00000068664
SMART Domains Protein: ENSMUSP00000063656
Gene: ENSMUSG00000032340

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
IGc2 76 147 9.49e-5 SMART
IGc2 175 239 4.43e-5 SMART
IGc2 272 338 6.15e-13 SMART
IGc2 364 428 7.76e-10 SMART
low complexity region 446 458 N/A INTRINSIC
FN3 470 553 8.23e-12 SMART
FN3 570 649 1.78e-16 SMART
FN3 665 749 1.54e-11 SMART
FN3 770 849 5.27e-10 SMART
FN3 885 970 7.63e-7 SMART
FN3 986 1072 2.78e-9 SMART
transmembrane domain 1136 1158 N/A INTRINSIC
Pfam:Neogenin_C 1189 1492 1.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217545
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface protein that is a member of the immunoglobulin superfamily. The encoded protein consists of four N-terminal immunoglobulin-like domains, six fibronectin type III domains, a transmembrane domain and a C-terminal internal domain that shares homology with the tumor suppressor candidate gene DCC. This protein may be involved in cell growth and differentiation and in cell-cell adhesion. Defects in this gene are associated with cell proliferation in certain cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display perinatal lethality and abnormal trigeminal nerve development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,842 probably benign Het
2210010C04Rik T C 6: 41,034,347 N34D probably benign Het
5730507C01Rik A T 12: 18,533,423 R161S possibly damaging Het
Adamts5 T C 16: 85,866,642 I735V probably benign Het
Arid1a G T 4: 133,681,124 P2024Q unknown Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
B3galt4 T C 17: 33,950,790 Y158C probably damaging Het
BC049715 A G 6: 136,840,145 T128A possibly damaging Het
Btaf1 T A 19: 36,945,229 I11N probably damaging Het
Cfb T C 17: 34,858,509 I496V probably damaging Het
Chd8 A T 14: 52,204,060 H858Q probably benign Het
Chrne T C 11: 70,615,723 I324V probably benign Het
Clec14a T C 12: 58,267,665 I390M probably damaging Het
Cpsf3 A G 12: 21,297,799 Y207C probably damaging Het
Cubn A C 2: 13,469,763 I410S possibly damaging Het
Cubn T A 2: 13,469,764 I410F possibly damaging Het
Dlc1 T C 8: 36,583,586 E997G possibly damaging Het
Emilin1 G T 5: 30,915,022 V71F probably damaging Het
Esrp2 T C 8: 106,134,675 E164G probably damaging Het
Fars2 A G 13: 36,537,311 T410A probably benign Het
Fat3 A G 9: 15,992,256 V2981A probably damaging Het
Fkbp15 G A 4: 62,326,136 T472I probably benign Het
Gm6871 A G 7: 41,573,445 V73A probably benign Het
Gnl2 T G 4: 125,053,527 S647R probably benign Het
Grb10 T C 11: 11,934,207 I500V possibly damaging Het
Herc1 T C 9: 66,446,074 probably benign Het
Iqgap2 A C 13: 95,689,699 probably null Het
Kcnu1 A T 8: 25,937,618 N321I probably benign Het
Kif23 G A 9: 61,926,405 R519* probably null Het
Klhl1 C T 14: 96,381,789 R224Q probably benign Het
Lama1 T C 17: 67,791,610 probably null Het
Lamp3 T C 16: 19,673,552 Y314C probably damaging Het
Lamtor5 C A 3: 107,281,911 R88S probably damaging Het
Nbea G T 3: 55,819,294 A2088E probably benign Het
Ntn4 A T 10: 93,682,429 R199S probably benign Het
Olfr1020 A T 2: 85,849,967 R172* probably null Het
Plekho2 A G 9: 65,557,052 S172P possibly damaging Het
Pmp2 T C 3: 10,180,763 Y129C probably damaging Het
Ralgapa2 A T 2: 146,428,672 M578K possibly damaging Het
Ranbp3 C T 17: 56,708,219 T307M possibly damaging Het
Serpinb11 G A 1: 107,376,860 W185* probably null Het
Setdb2 A T 14: 59,406,744 probably null Het
Sirpb1b A T 3: 15,548,596 V75E probably damaging Het
Slc13a1 A T 6: 24,100,293 L397Q probably damaging Het
Slc19a1 T A 10: 77,042,908 I355N probably damaging Het
Slc51a T A 16: 32,476,436 I275F possibly damaging Het
Spink14 T C 18: 44,031,867 S84P probably damaging Het
Stx2 A G 5: 128,993,577 probably benign Het
Tgfbi G T 13: 56,632,193 probably benign Het
Tshr T A 12: 91,537,869 M527K probably damaging Het
Upb1 T C 10: 75,412,883 V79A probably damaging Het
Zdhhc5 A T 2: 84,691,243 probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp280d T C 9: 72,312,237 V32A probably benign Het
Other mutations in Neo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Neo1 APN 9 58921919 splice site probably benign
IGL00885:Neo1 APN 9 58888463 missense probably damaging 1.00
IGL01103:Neo1 APN 9 58880799 missense possibly damaging 0.60
IGL01322:Neo1 APN 9 58907085 missense possibly damaging 0.68
IGL02216:Neo1 APN 9 58917053 missense probably damaging 0.96
IGL02327:Neo1 APN 9 58903088 missense probably benign 0.08
IGL02392:Neo1 APN 9 58925811 missense possibly damaging 0.49
IGL02458:Neo1 APN 9 58893867 splice site probably benign
IGL03057:Neo1 APN 9 58878059 missense probably damaging 1.00
IGL03091:Neo1 APN 9 58978668 missense probably damaging 0.98
IGL03193:Neo1 APN 9 58908484 missense probably damaging 1.00
R0097:Neo1 UTSW 9 58882021 intron probably benign
R0571:Neo1 UTSW 9 58985786 missense probably benign
R0646:Neo1 UTSW 9 58931034 missense probably damaging 1.00
R0736:Neo1 UTSW 9 58917081 missense possibly damaging 0.78
R0739:Neo1 UTSW 9 58921877 missense probably benign 0.22
R1636:Neo1 UTSW 9 58913277 missense probably damaging 1.00
R1694:Neo1 UTSW 9 58880603 missense probably damaging 1.00
R1827:Neo1 UTSW 9 58917031 nonsense probably null
R1927:Neo1 UTSW 9 58990385 missense probably benign 0.12
R2354:Neo1 UTSW 9 58985634 missense probably benign
R2365:Neo1 UTSW 9 58956003 missense probably benign
R3156:Neo1 UTSW 9 58888979 splice site probably null
R3552:Neo1 UTSW 9 58893878 missense probably damaging 1.00
R3829:Neo1 UTSW 9 58913169 missense possibly damaging 0.58
R4477:Neo1 UTSW 9 58877299 missense probably damaging 0.99
R4613:Neo1 UTSW 9 58889041 missense possibly damaging 0.94
R5023:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5046:Neo1 UTSW 9 58893911 missense possibly damaging 0.77
R5057:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5323:Neo1 UTSW 9 58906648 critical splice donor site probably null
R5394:Neo1 UTSW 9 58990234 missense probably benign 0.10
R5470:Neo1 UTSW 9 58931067 missense probably damaging 1.00
R5473:Neo1 UTSW 9 58880843 missense possibly damaging 0.88
R5500:Neo1 UTSW 9 58917054 missense possibly damaging 0.94
R5503:Neo1 UTSW 9 58985650 missense possibly damaging 0.67
R6122:Neo1 UTSW 9 58917008 missense probably benign
R6191:Neo1 UTSW 9 58889029 missense probably damaging 1.00
R6431:Neo1 UTSW 9 58907071 missense probably benign 0.27
R6560:Neo1 UTSW 9 58880601 missense possibly damaging 0.95
R6658:Neo1 UTSW 9 58921849 missense probably benign 0.14
R6772:Neo1 UTSW 9 58902976 missense probably damaging 1.00
R6912:Neo1 UTSW 9 58917052 missense probably benign 0.00
R7061:Neo1 UTSW 9 58990441 missense possibly damaging 0.95
R7145:Neo1 UTSW 9 58889179 missense probably damaging 1.00
R7156:Neo1 UTSW 9 58902923 missense probably damaging 1.00
X0063:Neo1 UTSW 9 58990298 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTCAGACAGGCAAGACGCACG -3'
(R):5'- GAATCAGATGATCGACGCCAGCTAC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GCCAGCTACTCCCAGATG -3'
Posted On2013-05-09