Incidental Mutation 'R4799:Ptprd'
ID369308
Institutional Source Beutler Lab
Gene Symbol Ptprd
Ensembl Gene ENSMUSG00000028399
Gene Nameprotein tyrosine phosphatase, receptor type, D
Synonyms1110002J03Rik, 3000002J10Rik, B230219D21Rik
MMRRC Submission 041997-MU
Accession Numbers

Ncbi RefSeq: NM_001014288.2, NM_011211.2; MGI:97812

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4799 (G1)
Quality Score200
Status Validated
Chromosome4
Chromosomal Location75941238-78211961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76091532 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 764 (I764T)
Ref Sequence ENSEMBL: ENSMUSP00000133973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050757] [ENSMUST00000098005] [ENSMUST00000102834] [ENSMUST00000107289] [ENSMUST00000173376] [ENSMUST00000174023] [ENSMUST00000174180] [ENSMUST00000174531] [ENSMUST00000174831]
Predicted Effect probably benign
Transcript: ENSMUST00000050757
SMART Domains Protein: ENSMUSP00000058466
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
IGc2 238 299 8.13e-4 SMART
FN3 313 392 7.92e-14 SMART
FN3 408 491 5.73e-11 SMART
IG_like 499 593 8.34e1 SMART
FN3 506 584 9.1e-14 SMART
FN3 597 674 1.21e0 SMART
transmembrane domain 847 869 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098005
SMART Domains Protein: ENSMUSP00000095614
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 886 897 N/A INTRINSIC
PTPc 950 1208 6.38e-134 SMART
PTPc 1237 1499 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102834
SMART Domains Protein: ENSMUSP00000099898
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 1 62 8.13e-4 SMART
FN3 76 155 7.92e-14 SMART
FN3 171 254 5.73e-11 SMART
IG_like 262 356 8.34e1 SMART
FN3 269 347 9.1e-14 SMART
FN3 360 437 1.21e0 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 633 645 N/A INTRINSIC
PTPc 698 956 6.38e-134 SMART
PTPc 985 1247 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107289
AA Change: I786T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102910
Gene: ENSMUSG00000028399
AA Change: I786T

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 609 696 2.72e-12 SMART
FN3 712 809 2.87e-11 SMART
FN3 824 904 4.96e-6 SMART
FN3 919 1003 4.12e-12 SMART
FN3 1018 1095 1.95e0 SMART
transmembrane domain 1268 1290 N/A INTRINSIC
low complexity region 1291 1303 N/A INTRINSIC
PTPc 1356 1614 6.38e-134 SMART
PTPc 1643 1905 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173376
SMART Domains Protein: ENSMUSP00000133468
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 43 112 8.57e-12 SMART
IGc2 145 221 8.5e-16 SMART
low complexity region 232 244 N/A INTRINSIC
IGc2 255 316 8.13e-4 SMART
FN3 330 409 7.92e-14 SMART
FN3 425 508 5.73e-11 SMART
IG_like 516 610 8.34e1 SMART
FN3 523 601 9.1e-14 SMART
FN3 614 691 1.21e0 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 887 899 N/A INTRINSIC
PTPc 952 1210 6.38e-134 SMART
PTPc 1239 1501 9.17e-135 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173560
Predicted Effect probably benign
Transcript: ENSMUST00000174023
SMART Domains Protein: ENSMUSP00000133562
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 211 4.88e-16 SMART
low complexity region 222 234 N/A INTRINSIC
IGc2 245 306 8.13e-4 SMART
FN3 320 399 7.92e-14 SMART
FN3 415 498 5.73e-11 SMART
IG_like 506 600 8.34e1 SMART
FN3 513 591 9.1e-14 SMART
FN3 604 681 1.21e0 SMART
transmembrane domain 853 875 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
PTPc 946 1204 6.38e-134 SMART
PTPc 1233 1495 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174180
AA Change: I764T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000133973
Gene: ENSMUSG00000028399
AA Change: I764T

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 205 2.09e-15 SMART
IGc2 235 296 8.13e-4 SMART
FN3 310 389 7.92e-14 SMART
FN3 405 488 5.73e-11 SMART
IG_like 496 590 8.34e1 SMART
FN3 503 581 9.1e-14 SMART
FN3 596 683 2.72e-12 SMART
FN3 699 787 6.15e-11 SMART
FN3 802 882 4.96e-6 SMART
FN3 897 981 4.12e-12 SMART
FN3 996 1073 1.95e0 SMART
transmembrane domain 1246 1268 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
PTPc 1334 1592 6.38e-134 SMART
PTPc 1621 1883 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174531
SMART Domains Protein: ENSMUSP00000134229
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
low complexity region 219 231 N/A INTRINSIC
IGc2 242 303 8.13e-4 SMART
FN3 317 396 7.92e-14 SMART
FN3 412 495 5.73e-11 SMART
IG_like 503 597 8.34e1 SMART
FN3 510 588 9.1e-14 SMART
FN3 601 678 1.21e0 SMART
transmembrane domain 851 873 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
PTPc 939 1197 6.38e-134 SMART
PTPc 1226 1488 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174831
SMART Domains Protein: ENSMUSP00000133328
Gene: ENSMUSG00000028399

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (122/126)
MGI Phenotype Strain: 2158795
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired learning of spatial tasks, enhanced long-term potentiation at hippocampal synapses, and high mortality associated with reduced food intake. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)
 

Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b C G 12: 70,169,064 S170C probably damaging Het
Acads T A 5: 115,113,090 T112S probably benign Het
Adgrl1 A G 8: 83,935,573 H1021R probably benign Het
Ago3 A T 4: 126,347,872 probably null Het
Ap5m1 A G 14: 49,081,070 K412E probably benign Het
Arid1b C T 17: 5,339,221 P1681S probably damaging Het
Atxn10 T C 15: 85,376,708 probably null Het
AU040320 A G 4: 126,839,669 T661A probably benign Het
Capn7 T C 14: 31,360,557 I455M probably benign Het
Capzb A G 4: 139,192,999 probably benign Het
Car10 G A 11: 93,578,666 V156I possibly damaging Het
Cbs T A 17: 31,632,852 D59V probably damaging Het
Ccar2 T C 14: 70,139,554 E819G probably damaging Het
Cdc73 T A 1: 143,627,875 Q346L probably benign Het
Cdhr4 T C 9: 107,998,699 probably benign Het
Chd2 A T 7: 73,484,436 M721K possibly damaging Het
Cntnap5b G A 1: 100,358,725 G402R probably benign Het
Cps1 T C 1: 67,142,986 Y120H probably damaging Het
Csf2 T C 11: 54,249,480 D44G probably benign Het
Cubn T A 2: 13,287,024 Q3330L possibly damaging Het
Cubn A G 2: 13,351,058 S1788P probably damaging Het
Cul9 T C 17: 46,500,844 D2486G possibly damaging Het
Cyp2c40 A T 19: 39,773,849 S451R probably damaging Het
Cyp51 T A 5: 4,083,256 T461S probably damaging Het
Cyth1 T C 11: 118,183,942 M164V probably damaging Het
D130043K22Rik T C 13: 24,878,040 I664T probably damaging Het
Ddc T C 11: 11,846,632 probably null Het
Ddx21 A T 10: 62,588,121 D589E probably damaging Het
Dgkb C T 12: 38,114,568 R113C possibly damaging Het
Dglucy A T 12: 100,850,343 M415L probably benign Het
Efnb2 A T 8: 8,623,104 probably null Het
Elp4 T A 2: 105,809,267 Q189L probably damaging Het
Enpp2 T C 15: 54,910,094 N77S probably damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
F2rl1 G A 13: 95,513,969 S135F possibly damaging Het
Fam133b T C 5: 3,557,815 M65T probably damaging Het
Fanca A G 8: 123,288,202 V689A probably damaging Het
Fbxo18 C T 2: 11,755,747 C79Y probably damaging Het
Fbxw7 C T 3: 84,903,861 Q98* probably null Het
Flrt3 T C 2: 140,660,166 N514S probably damaging Het
Foxj3 A T 4: 119,621,660 S438C unknown Het
Gcm2 T C 13: 41,103,494 K260E possibly damaging Het
Gm12863 C T 4: 118,954,488 noncoding transcript Het
Gm5096 C A 18: 87,756,449 A32E probably damaging Het
Gpnmb G T 6: 49,045,483 probably null Het
Gsap C A 5: 21,250,943 N379K probably benign Het
Hsd3b1 T A 3: 98,852,865 Y270F probably benign Het
Il22 C A 10: 118,205,153 R55S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhdc3 T C 17: 46,677,300 R180G possibly damaging Het
Lmbrd1 G A 1: 24,744,975 probably null Het
Lrrcc1 C T 3: 14,536,096 R63* probably null Het
Lyar A G 5: 38,224,779 D35G probably damaging Het
Mbd4 C T 6: 115,845,322 R442Q probably benign Het
Mib2 G T 4: 155,659,772 S144R probably benign Het
Mms22l A T 4: 24,580,052 probably null Het
Mtmr3 G A 11: 4,487,764 H897Y probably benign Het
Muc5b T A 7: 141,847,716 C566* probably null Het
Nap1l4 A T 7: 143,534,463 probably null Het
Ncor2 A T 5: 125,037,060 probably null Het
Ndufa7 T C 17: 33,838,213 probably benign Het
Ndufs1 C A 1: 63,160,949 G268V probably damaging Het
Nfs1 A G 2: 156,134,449 V175A possibly damaging Het
Obsl1 C A 1: 75,489,501 A1528S possibly damaging Het
Olfr1089 C T 2: 86,732,674 probably null Het
Olfr1252 C T 2: 89,721,362 V250I probably benign Het
Olfr372 A G 8: 72,058,094 N138S probably benign Het
Olfr67 A T 7: 103,787,481 F265L possibly damaging Het
Olfr8 T G 10: 78,956,097 D297E probably null Het
Pcdhb8 A G 18: 37,355,653 D128G probably damaging Het
Pkp4 A T 2: 59,342,105 I522F probably damaging Het
Plod3 G A 5: 136,990,800 A398T probably benign Het
Pou4f3 A G 18: 42,395,987 M332V possibly damaging Het
Prox1 A G 1: 190,153,472 F593L probably damaging Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Prss50 A G 9: 110,863,796 D328G probably damaging Het
Psmd6 C T 14: 14,120,126 S71N probably benign Het
Ptprr C T 10: 116,048,218 A60V probably benign Het
Raet1e T A 10: 22,181,300 D174E probably damaging Het
Rbfox2 T C 15: 77,091,818 I308M probably benign Het
Rnf20 G C 4: 49,649,962 probably null Het
Rpap2 A T 5: 107,620,247 H317L probably benign Het
Rsph6a T A 7: 19,065,858 Y471* probably null Het
Sdhb A G 4: 140,977,466 H246R possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Sin3b A C 8: 72,725,643 I126L probably benign Het
Skint2 G A 4: 112,652,108 A363T probably benign Het
Slc22a30 A G 19: 8,344,404 I432T probably benign Het
Slc2a2 G A 3: 28,717,532 probably null Het
Slco1a5 T C 6: 142,248,807 Y370C possibly damaging Het
Sltm A G 9: 70,589,057 H958R probably damaging Het
Smpdl3a C T 10: 57,808,015 H290Y probably damaging Het
Snrnp40 A G 4: 130,362,756 I91M probably damaging Het
Spag9 A T 11: 94,048,516 K90N possibly damaging Het
Spag9 T A 11: 94,048,517 F91I probably damaging Het
Stox1 A C 10: 62,665,737 I348S probably damaging Het
Sult1e1 A G 5: 87,590,168 V18A possibly damaging Het
Syne2 A G 12: 75,899,167 M338V probably benign Het
Tbc1d23 T A 16: 57,192,628 Q327L probably benign Het
Terf2 G T 8: 107,076,675 H425Q probably benign Het
Timd2 A T 11: 46,677,267 Y233* probably null Het
Tmem39a A G 16: 38,591,162 probably benign Het
Trappc10 T C 10: 78,201,590 D793G possibly damaging Het
Ttc30a2 T A 2: 75,977,385 Y261F probably benign Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Unc93a T C 17: 13,120,895 probably null Het
Utrn T C 10: 12,750,069 T123A probably damaging Het
Vmn1r171 T C 7: 23,632,944 I198T probably benign Het
Vmn1r213 T A 13: 23,011,846 S200T probably damaging Het
Vmn2r108 T A 17: 20,462,629 D771V probably damaging Het
Wdr66 C T 5: 123,302,772 H1131Y probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zc3h13 G A 14: 75,339,423 C1657Y probably damaging Het
Zdhhc5 T C 2: 84,693,431 K224E probably damaging Het
Zfp54 T A 17: 21,434,140 Y299N probably damaging Het
Zfp820 A T 17: 21,818,985 L454Q probably benign Het
Zfp960 T A 17: 17,088,436 F471I probably damaging Het
Zswim5 A G 4: 116,972,972 I515V probably benign Het
Zzef1 G T 11: 72,859,623 S919I probably benign Het
Other mutations in Ptprd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Ptprd APN 4 75998556 nonsense probably null
IGL01067:Ptprd APN 4 76059685 missense probably damaging 1.00
IGL01121:Ptprd APN 4 75954201 splice site probably benign
IGL01531:Ptprd APN 4 76085520 missense probably damaging 0.98
IGL01661:Ptprd APN 4 75954083 missense probably damaging 1.00
IGL01723:Ptprd APN 4 76243673 missense probably damaging 1.00
IGL01735:Ptprd APN 4 76136820 unclassified probably null
IGL01810:Ptprd APN 4 76140507 splice site probably benign
IGL01834:Ptprd APN 4 76128595 missense probably damaging 1.00
IGL01835:Ptprd APN 4 76246821 missense probably benign 0.02
IGL01867:Ptprd APN 4 76243647 missense probably damaging 1.00
IGL02582:Ptprd APN 4 75947124 missense probably damaging 1.00
IGL02591:Ptprd APN 4 75982050 missense probably damaging 1.00
IGL02741:Ptprd APN 4 76133284 missense probably damaging 1.00
IGL02866:Ptprd APN 4 76050437 missense probably damaging 1.00
IGL02960:Ptprd APN 4 76128868 missense probably damaging 1.00
IGL03155:Ptprd APN 4 76066219 missense possibly damaging 0.95
IGL03230:Ptprd APN 4 76050417 nonsense probably null
IGL03343:Ptprd APN 4 76059729 missense probably damaging 1.00
ANU22:Ptprd UTSW 4 76100456 missense probably damaging 0.99
F5493:Ptprd UTSW 4 76084408 missense probably damaging 1.00
P0033:Ptprd UTSW 4 76128854 nonsense probably null
R0044:Ptprd UTSW 4 76086329 missense probably benign 0.08
R0044:Ptprd UTSW 4 76086329 missense probably benign 0.08
R0076:Ptprd UTSW 4 75947039 splice site probably benign
R0137:Ptprd UTSW 4 76136903 missense probably benign 0.24
R0358:Ptprd UTSW 4 75944989 missense probably damaging 1.00
R0365:Ptprd UTSW 4 76136846 missense probably damaging 1.00
R0385:Ptprd UTSW 4 76128665 missense probably damaging 1.00
R0601:Ptprd UTSW 4 76100474 missense probably benign
R0646:Ptprd UTSW 4 76084403 missense probably damaging 0.99
R0667:Ptprd UTSW 4 75957346 missense probably damaging 1.00
R0707:Ptprd UTSW 4 75957239 missense probably damaging 1.00
R0734:Ptprd UTSW 4 76140597 missense probably damaging 1.00
R0827:Ptprd UTSW 4 76128915 missense probably damaging 0.98
R0932:Ptprd UTSW 4 76136885 missense probably damaging 1.00
R1069:Ptprd UTSW 4 75998487 splice site probably benign
R1069:Ptprd UTSW 4 76100633 nonsense probably null
R1086:Ptprd UTSW 4 76133258 missense probably damaging 1.00
R1439:Ptprd UTSW 4 76066200 missense probably damaging 1.00
R1440:Ptprd UTSW 4 76084552 missense probably damaging 0.98
R1688:Ptprd UTSW 4 75982684 missense probably damaging 1.00
R1858:Ptprd UTSW 4 75947147 missense probably damaging 1.00
R2001:Ptprd UTSW 4 75954122 missense probably damaging 1.00
R2020:Ptprd UTSW 4 76133161 missense probably damaging 1.00
R2023:Ptprd UTSW 4 75957104 missense probably damaging 1.00
R2413:Ptprd UTSW 4 76133200 missense probably damaging 1.00
R2510:Ptprd UTSW 4 76086011 critical splice donor site probably null
R2914:Ptprd UTSW 4 75947101 missense probably damaging 1.00
R2971:Ptprd UTSW 4 76107324 missense probably benign 0.10
R3051:Ptprd UTSW 4 76100630 missense probably damaging 1.00
R3433:Ptprd UTSW 4 76086011 critical splice donor site probably null
R3964:Ptprd UTSW 4 76059836 splice site probably benign
R4009:Ptprd UTSW 4 75956397 missense possibly damaging 0.94
R4394:Ptprd UTSW 4 76128685 missense probably damaging 1.00
R4420:Ptprd UTSW 4 76039377 missense possibly damaging 0.92
R4424:Ptprd UTSW 4 76102963 missense probably benign 0.22
R4575:Ptprd UTSW 4 76243786 missense possibly damaging 0.55
R4578:Ptprd UTSW 4 76243786 missense possibly damaging 0.55
R4715:Ptprd UTSW 4 76107333 missense probably benign 0.03
R4782:Ptprd UTSW 4 76091532 missense probably benign 0.01
R4785:Ptprd UTSW 4 76140553 missense probably benign 0.05
R4944:Ptprd UTSW 4 76128899 missense probably damaging 1.00
R4950:Ptprd UTSW 4 76140515 splice site probably null
R4969:Ptprd UTSW 4 76133305 missense probably damaging 1.00
R5153:Ptprd UTSW 4 76012102 missense probably damaging 1.00
R5164:Ptprd UTSW 4 76100758 splice site probably null
R5287:Ptprd UTSW 4 75954168 nonsense probably null
R5305:Ptprd UTSW 4 75982626 missense probably damaging 1.00
R5362:Ptprd UTSW 4 76128813 missense probably damaging 1.00
R5403:Ptprd UTSW 4 75954168 nonsense probably null
R5531:Ptprd UTSW 4 76059667 critical splice donor site probably null
R5543:Ptprd UTSW 4 76059753 missense probably damaging 1.00
R5634:Ptprd UTSW 4 76072018 missense probably benign 0.01
R5719:Ptprd UTSW 4 76054602 critical splice acceptor site probably null
R5884:Ptprd UTSW 4 75982690 missense probably damaging 1.00
R6247:Ptprd UTSW 4 76066291 missense probably benign 0.06
R6250:Ptprd UTSW 4 76128995 missense probably damaging 1.00
R6335:Ptprd UTSW 4 75954183 missense probably damaging 1.00
R6352:Ptprd UTSW 4 76091552 unclassified probably null
R6533:Ptprd UTSW 4 76128528 missense probably damaging 1.00
R6756:Ptprd UTSW 4 75955299 missense probably damaging 1.00
R6782:Ptprd UTSW 4 76325140 intron probably null
Predicted Primers PCR Primer
(F):5'- GAGTGCAGTCTATTTTCTCTCAGTG -3'
(R):5'- ATGCTCGAATATCCCCAACTTC -3'

Sequencing Primer
(F):5'- CACAGAAGACATTACCTGC -3'
(R):5'- TCCCCAACTTCACTATTAACATCCAG -3'
Posted On2016-02-04