Incidental Mutation 'R4799:Ncor2'
ID369328
Institutional Source Beutler Lab
Gene Symbol Ncor2
Ensembl Gene ENSMUSG00000029478
Gene Namenuclear receptor co-repressor 2
SynonymsSMRT, SMRTe
MMRRC Submission 041997-MU
Accession Numbers

Ncbi RefSeq: NM_011424.3, NM_001253904.1, NM_001253905.1; MGI:1337080

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4799 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location125017153-125179219 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 125037060 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055256] [ENSMUST00000086083] [ENSMUST00000111393] [ENSMUST00000111394] [ENSMUST00000111398] [ENSMUST00000111402] [ENSMUST00000134404]
Predicted Effect probably benign
Transcript: ENSMUST00000055256
SMART Domains Protein: ENSMUSP00000055954
Gene: ENSMUSG00000029478

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 989 1000 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1100 1116 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1481 1497 N/A INTRINSIC
low complexity region 1616 1622 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1737 1754 N/A INTRINSIC
low complexity region 1764 1776 N/A INTRINSIC
low complexity region 1800 1807 N/A INTRINSIC
low complexity region 1921 1939 N/A INTRINSIC
low complexity region 1959 1975 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
PDB:2GPV|I 2293 2314 8e-8 PDB
low complexity region 2324 2336 N/A INTRINSIC
low complexity region 2433 2453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086083
SMART Domains Protein: ENSMUSP00000083250
Gene: ENSMUSG00000029478

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1364 1378 N/A INTRINSIC
low complexity region 1479 1495 N/A INTRINSIC
low complexity region 1614 1620 N/A INTRINSIC
low complexity region 1707 1724 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
low complexity region 1762 1774 N/A INTRINSIC
low complexity region 1798 1805 N/A INTRINSIC
low complexity region 1916 1934 N/A INTRINSIC
low complexity region 1954 1970 N/A INTRINSIC
low complexity region 2057 2071 N/A INTRINSIC
PDB:2GPV|I 2288 2309 8e-8 PDB
low complexity region 2319 2331 N/A INTRINSIC
low complexity region 2428 2448 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111393
SMART Domains Protein: ENSMUSP00000107024
Gene: ENSMUSG00000029478

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
SANT 253 301 4.42e-6 SMART
coiled coil region 319 375 N/A INTRINSIC
SANT 432 480 1.43e-14 SMART
low complexity region 493 511 N/A INTRINSIC
low complexity region 524 551 N/A INTRINSIC
low complexity region 593 638 N/A INTRINSIC
low complexity region 647 653 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 692 699 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
low complexity region 760 769 N/A INTRINSIC
low complexity region 813 824 N/A INTRINSIC
low complexity region 835 849 N/A INTRINSIC
low complexity region 851 867 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
low complexity region 1225 1239 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
low complexity region 1475 1481 N/A INTRINSIC
low complexity region 1568 1585 N/A INTRINSIC
low complexity region 1596 1613 N/A INTRINSIC
low complexity region 1623 1635 N/A INTRINSIC
low complexity region 1659 1666 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
low complexity region 1921 1935 N/A INTRINSIC
PDB:2GPV|I 2152 2173 7e-8 PDB
low complexity region 2183 2195 N/A INTRINSIC
low complexity region 2292 2312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111394
SMART Domains Protein: ENSMUSP00000107025
Gene: ENSMUSG00000029478

DomainStartEndE-ValueType
SANT 209 257 4.42e-6 SMART
coiled coil region 275 331 N/A INTRINSIC
SANT 388 436 1.43e-14 SMART
low complexity region 449 467 N/A INTRINSIC
low complexity region 480 507 N/A INTRINSIC
low complexity region 549 594 N/A INTRINSIC
low complexity region 603 609 N/A INTRINSIC
low complexity region 629 641 N/A INTRINSIC
low complexity region 648 655 N/A INTRINSIC
low complexity region 686 700 N/A INTRINSIC
low complexity region 716 725 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
low complexity region 807 823 N/A INTRINSIC
low complexity region 866 876 N/A INTRINSIC
low complexity region 880 896 N/A INTRINSIC
low complexity region 1146 1160 N/A INTRINSIC
low complexity region 1261 1277 N/A INTRINSIC
low complexity region 1396 1402 N/A INTRINSIC
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1517 1534 N/A INTRINSIC
low complexity region 1544 1556 N/A INTRINSIC
low complexity region 1580 1587 N/A INTRINSIC
low complexity region 1701 1719 N/A INTRINSIC
low complexity region 1739 1755 N/A INTRINSIC
low complexity region 1842 1856 N/A INTRINSIC
PDB:2GPV|I 2073 2094 7e-8 PDB
low complexity region 2104 2116 N/A INTRINSIC
low complexity region 2213 2233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111398
SMART Domains Protein: ENSMUSP00000107029
Gene: ENSMUSG00000029478

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1365 1379 N/A INTRINSIC
low complexity region 1480 1496 N/A INTRINSIC
low complexity region 1615 1621 N/A INTRINSIC
low complexity region 1708 1725 N/A INTRINSIC
low complexity region 1736 1753 N/A INTRINSIC
low complexity region 1763 1775 N/A INTRINSIC
low complexity region 1799 1806 N/A INTRINSIC
low complexity region 1920 1938 N/A INTRINSIC
low complexity region 1958 1974 N/A INTRINSIC
low complexity region 2061 2075 N/A INTRINSIC
PDB:2GPV|I 2292 2313 8e-8 PDB
low complexity region 2323 2335 N/A INTRINSIC
low complexity region 2432 2452 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111402
SMART Domains Protein: ENSMUSP00000107033
Gene: ENSMUSG00000029478

DomainStartEndE-ValueType
Pfam:GPS2_interact 141 229 4.9e-41 PFAM
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1400 1414 N/A INTRINSIC
low complexity region 1515 1531 N/A INTRINSIC
low complexity region 1650 1656 N/A INTRINSIC
low complexity region 1743 1760 N/A INTRINSIC
low complexity region 1771 1788 N/A INTRINSIC
low complexity region 1798 1810 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1955 1973 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2096 2110 N/A INTRINSIC
PDB:2GPV|I 2327 2348 8e-8 PDB
low complexity region 2358 2370 N/A INTRINSIC
low complexity region 2467 2487 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000125053
SMART Domains Protein: ENSMUSP00000117098
Gene: ENSMUSG00000029478

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 133 143 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 448 462 N/A INTRINSIC
low complexity region 563 579 N/A INTRINSIC
low complexity region 698 704 N/A INTRINSIC
low complexity region 791 808 N/A INTRINSIC
low complexity region 819 836 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
low complexity region 1000 1018 N/A INTRINSIC
low complexity region 1038 1054 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
PDB:2GPV|I 1372 1393 5e-8 PDB
low complexity region 1403 1415 N/A INTRINSIC
low complexity region 1512 1532 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134404
SMART Domains Protein: ENSMUSP00000121588
Gene: ENSMUSG00000029478

DomainStartEndE-ValueType
SANT 2 49 1.94e-2 SMART
low complexity region 84 100 N/A INTRINSIC
low complexity region 113 140 N/A INTRINSIC
low complexity region 182 227 N/A INTRINSIC
low complexity region 236 242 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
low complexity region 281 288 N/A INTRINSIC
low complexity region 319 333 N/A INTRINSIC
low complexity region 349 358 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 424 438 N/A INTRINSIC
low complexity region 440 456 N/A INTRINSIC
low complexity region 499 509 N/A INTRINSIC
low complexity region 513 529 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
Meta Mutation Damage Score 0.538 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (122/126)
MGI Phenotype Strain: 3765904; 4329504
Lethality: E1-E16
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear receptor co-repressor that mediates transcriptional silencing of certain target genes. The encoded protein is a member of a family of thyroid hormone- and retinoic acid receptor-associated co-repressors. This protein acts as part of a multisubunit complex which includes histone deacetylases to modify chromatin structure that prevents basal transcriptional activity of target genes. Aberrant expression of this gene is associated with certain cancers. Alternate splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a null allele die before E16.5 of heart defects and exhibit neural defects. [provided by MGI curators]
Allele List at MGI

All alleles(145) : Targeted(2) Gene trapped(143)

Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b C G 12: 70,169,064 S170C probably damaging Het
Acads T A 5: 115,113,090 T112S probably benign Het
Adgrl1 A G 8: 83,935,573 H1021R probably benign Het
Ago3 A T 4: 126,347,872 probably null Het
Ap5m1 A G 14: 49,081,070 K412E probably benign Het
Arid1b C T 17: 5,339,221 P1681S probably damaging Het
Atxn10 T C 15: 85,376,708 probably null Het
AU040320 A G 4: 126,839,669 T661A probably benign Het
Capn7 T C 14: 31,360,557 I455M probably benign Het
Capzb A G 4: 139,192,999 probably benign Het
Car10 G A 11: 93,578,666 V156I possibly damaging Het
Cbs T A 17: 31,632,852 D59V probably damaging Het
Ccar2 T C 14: 70,139,554 E819G probably damaging Het
Cdc73 T A 1: 143,627,875 Q346L probably benign Het
Cdhr4 T C 9: 107,998,699 probably benign Het
Chd2 A T 7: 73,484,436 M721K possibly damaging Het
Cntnap5b G A 1: 100,358,725 G402R probably benign Het
Cps1 T C 1: 67,142,986 Y120H probably damaging Het
Csf2 T C 11: 54,249,480 D44G probably benign Het
Cubn T A 2: 13,287,024 Q3330L possibly damaging Het
Cubn A G 2: 13,351,058 S1788P probably damaging Het
Cul9 T C 17: 46,500,844 D2486G possibly damaging Het
Cyp2c40 A T 19: 39,773,849 S451R probably damaging Het
Cyp51 T A 5: 4,083,256 T461S probably damaging Het
Cyth1 T C 11: 118,183,942 M164V probably damaging Het
D130043K22Rik T C 13: 24,878,040 I664T probably damaging Het
Ddc T C 11: 11,846,632 probably null Het
Ddx21 A T 10: 62,588,121 D589E probably damaging Het
Dgkb C T 12: 38,114,568 R113C possibly damaging Het
Dglucy A T 12: 100,850,343 M415L probably benign Het
Efnb2 A T 8: 8,623,104 probably null Het
Elp4 T A 2: 105,809,267 Q189L probably damaging Het
Enpp2 T C 15: 54,910,094 N77S probably damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
F2rl1 G A 13: 95,513,969 S135F possibly damaging Het
Fam133b T C 5: 3,557,815 M65T probably damaging Het
Fanca A G 8: 123,288,202 V689A probably damaging Het
Fbxo18 C T 2: 11,755,747 C79Y probably damaging Het
Fbxw7 C T 3: 84,903,861 Q98* probably null Het
Flrt3 T C 2: 140,660,166 N514S probably damaging Het
Foxj3 A T 4: 119,621,660 S438C unknown Het
Gcm2 T C 13: 41,103,494 K260E possibly damaging Het
Gm12863 C T 4: 118,954,488 noncoding transcript Het
Gm5096 C A 18: 87,756,449 A32E probably damaging Het
Gpnmb G T 6: 49,045,483 probably null Het
Gsap C A 5: 21,250,943 N379K probably benign Het
Hsd3b1 T A 3: 98,852,865 Y270F probably benign Het
Il22 C A 10: 118,205,153 R55S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhdc3 T C 17: 46,677,300 R180G possibly damaging Het
Lmbrd1 G A 1: 24,744,975 probably null Het
Lrrcc1 C T 3: 14,536,096 R63* probably null Het
Lyar A G 5: 38,224,779 D35G probably damaging Het
Mbd4 C T 6: 115,845,322 R442Q probably benign Het
Mib2 G T 4: 155,659,772 S144R probably benign Het
Mms22l A T 4: 24,580,052 probably null Het
Mtmr3 G A 11: 4,487,764 H897Y probably benign Het
Muc5b T A 7: 141,847,716 C566* probably null Het
Nap1l4 A T 7: 143,534,463 probably null Het
Ndufa7 T C 17: 33,838,213 probably benign Het
Ndufs1 C A 1: 63,160,949 G268V probably damaging Het
Nfs1 A G 2: 156,134,449 V175A possibly damaging Het
Obsl1 C A 1: 75,489,501 A1528S possibly damaging Het
Olfr1089 C T 2: 86,732,674 probably null Het
Olfr1252 C T 2: 89,721,362 V250I probably benign Het
Olfr372 A G 8: 72,058,094 N138S probably benign Het
Olfr67 A T 7: 103,787,481 F265L possibly damaging Het
Olfr8 T G 10: 78,956,097 D297E probably null Het
Pcdhb8 A G 18: 37,355,653 D128G probably damaging Het
Pkp4 A T 2: 59,342,105 I522F probably damaging Het
Plod3 G A 5: 136,990,800 A398T probably benign Het
Pou4f3 A G 18: 42,395,987 M332V possibly damaging Het
Prox1 A G 1: 190,153,472 F593L probably damaging Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Prss50 A G 9: 110,863,796 D328G probably damaging Het
Psmd6 C T 14: 14,120,126 S71N probably benign Het
Ptprd A G 4: 76,091,532 I764T probably benign Het
Ptprr C T 10: 116,048,218 A60V probably benign Het
Raet1e T A 10: 22,181,300 D174E probably damaging Het
Rbfox2 T C 15: 77,091,818 I308M probably benign Het
Rnf20 G C 4: 49,649,962 probably null Het
Rpap2 A T 5: 107,620,247 H317L probably benign Het
Rsph6a T A 7: 19,065,858 Y471* probably null Het
Sdhb A G 4: 140,977,466 H246R possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Sin3b A C 8: 72,725,643 I126L probably benign Het
Skint2 G A 4: 112,652,108 A363T probably benign Het
Slc22a30 A G 19: 8,344,404 I432T probably benign Het
Slc2a2 G A 3: 28,717,532 probably null Het
Slco1a5 T C 6: 142,248,807 Y370C possibly damaging Het
Sltm A G 9: 70,589,057 H958R probably damaging Het
Smpdl3a C T 10: 57,808,015 H290Y probably damaging Het
Snrnp40 A G 4: 130,362,756 I91M probably damaging Het
Spag9 A T 11: 94,048,516 K90N possibly damaging Het
Spag9 T A 11: 94,048,517 F91I probably damaging Het
Stox1 A C 10: 62,665,737 I348S probably damaging Het
Sult1e1 A G 5: 87,590,168 V18A possibly damaging Het
Syne2 A G 12: 75,899,167 M338V probably benign Het
Tbc1d23 T A 16: 57,192,628 Q327L probably benign Het
Terf2 G T 8: 107,076,675 H425Q probably benign Het
Timd2 A T 11: 46,677,267 Y233* probably null Het
Tmem39a A G 16: 38,591,162 probably benign Het
Trappc10 T C 10: 78,201,590 D793G possibly damaging Het
Ttc30a2 T A 2: 75,977,385 Y261F probably benign Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Unc93a T C 17: 13,120,895 probably null Het
Utrn T C 10: 12,750,069 T123A probably damaging Het
Vmn1r171 T C 7: 23,632,944 I198T probably benign Het
Vmn1r213 T A 13: 23,011,846 S200T probably damaging Het
Vmn2r108 T A 17: 20,462,629 D771V probably damaging Het
Wdr66 C T 5: 123,302,772 H1131Y probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zc3h13 G A 14: 75,339,423 C1657Y probably damaging Het
Zdhhc5 T C 2: 84,693,431 K224E probably damaging Het
Zfp54 T A 17: 21,434,140 Y299N probably damaging Het
Zfp820 A T 17: 21,818,985 L454Q probably benign Het
Zfp960 T A 17: 17,088,436 F471I probably damaging Het
Zswim5 A G 4: 116,972,972 I515V probably benign Het
Zzef1 G T 11: 72,859,623 S919I probably benign Het
Other mutations in Ncor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Ncor2 APN 5 125042743 critical splice donor site probably null
IGL00519:Ncor2 APN 5 125084924 missense unknown
IGL00900:Ncor2 APN 5 125025784 missense probably damaging 1.00
IGL00950:Ncor2 APN 5 125086890 missense unknown
IGL01320:Ncor2 APN 5 125109927 missense probably benign 0.00
IGL01382:Ncor2 APN 5 125055773 missense probably damaging 0.96
IGL01573:Ncor2 APN 5 125085026 missense unknown
IGL01721:Ncor2 APN 5 125050937 missense probably damaging 1.00
IGL01875:Ncor2 APN 5 125065870 missense unknown
IGL02090:Ncor2 APN 5 125034403 missense probably damaging 0.99
IGL02192:Ncor2 APN 5 125024237 missense probably damaging 1.00
IGL02396:Ncor2 APN 5 125037914 missense probably damaging 1.00
IGL02934:Ncor2 APN 5 125025557 missense probably benign 0.33
IGL02997:Ncor2 APN 5 125119570 intron probably benign
R0019:Ncor2 UTSW 5 125119481 critical splice donor site probably null
R0331:Ncor2 UTSW 5 125084917 missense unknown
R0333:Ncor2 UTSW 5 125034344 splice site probably benign
R0403:Ncor2 UTSW 5 125033337 missense possibly damaging 0.73
R0557:Ncor2 UTSW 5 125106305 nonsense probably null
R0562:Ncor2 UTSW 5 125085029 missense unknown
R0671:Ncor2 UTSW 5 125049387 missense probably benign 0.13
R0699:Ncor2 UTSW 5 125029112 unclassified probably benign
R0865:Ncor2 UTSW 5 125038982 missense probably benign 0.17
R1183:Ncor2 UTSW 5 125023521 missense possibly damaging 0.65
R1325:Ncor2 UTSW 5 125118780 intron probably benign
R1344:Ncor2 UTSW 5 125025446 missense probably damaging 1.00
R1433:Ncor2 UTSW 5 125109975 intron probably benign
R1481:Ncor2 UTSW 5 125027138 nonsense probably null
R1539:Ncor2 UTSW 5 125109939 missense probably benign 0.07
R1558:Ncor2 UTSW 5 125033546 missense probably damaging 1.00
R1585:Ncor2 UTSW 5 125084998 missense unknown
R1611:Ncor2 UTSW 5 125110020 intron probably benign
R1764:Ncor2 UTSW 5 125028615 missense possibly damaging 0.91
R1789:Ncor2 UTSW 5 125019890 missense probably damaging 1.00
R1809:Ncor2 UTSW 5 125118793 intron probably benign
R1901:Ncor2 UTSW 5 125025425 missense probably benign 0.39
R1946:Ncor2 UTSW 5 125034412 missense probably damaging 1.00
R1970:Ncor2 UTSW 5 125038918 missense probably damaging 0.99
R2048:Ncor2 UTSW 5 125084932 missense unknown
R2137:Ncor2 UTSW 5 125030712 missense probably damaging 1.00
R2270:Ncor2 UTSW 5 125037955 missense probably benign 0.33
R2380:Ncor2 UTSW 5 125036080 missense possibly damaging 0.89
R2570:Ncor2 UTSW 5 125028800 critical splice acceptor site probably null
R2918:Ncor2 UTSW 5 125025760 missense probably damaging 0.99
R2921:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R2922:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R2923:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R3116:Ncor2 UTSW 5 125024166 missense probably damaging 1.00
R3768:Ncor2 UTSW 5 125028687 missense probably damaging 1.00
R3826:Ncor2 UTSW 5 125118692 intron probably benign
R3829:Ncor2 UTSW 5 125118692 intron probably benign
R3830:Ncor2 UTSW 5 125118692 intron probably benign
R3951:Ncor2 UTSW 5 125032256 missense possibly damaging 0.94
R4175:Ncor2 UTSW 5 125050956 missense probably damaging 0.99
R4360:Ncor2 UTSW 5 125028972 missense probably damaging 1.00
R4470:Ncor2 UTSW 5 125102641 critical splice donor site probably null
R4490:Ncor2 UTSW 5 125036815 splice site probably null
R4573:Ncor2 UTSW 5 125055825 missense probably damaging 0.99
R4611:Ncor2 UTSW 5 125030859 missense probably damaging 1.00
R4851:Ncor2 UTSW 5 125033367 missense possibly damaging 0.93
R4853:Ncor2 UTSW 5 125025105 missense probably damaging 0.99
R4853:Ncor2 UTSW 5 125081183 missense unknown
R4896:Ncor2 UTSW 5 125049340 critical splice donor site probably null
R4997:Ncor2 UTSW 5 125034010 missense probably damaging 0.99
R5057:Ncor2 UTSW 5 125048066 missense possibly damaging 0.86
R5253:Ncor2 UTSW 5 125026930 missense probably benign 0.44
R5461:Ncor2 UTSW 5 125027113 missense probably damaging 1.00
R5585:Ncor2 UTSW 5 125067911 nonsense probably null
R5638:Ncor2 UTSW 5 125048300 missense probably benign 0.33
R5879:Ncor2 UTSW 5 125026775 unclassified probably benign
R5967:Ncor2 UTSW 5 125068984 missense unknown
R5999:Ncor2 UTSW 5 125033441 missense probably damaging 1.00
R6020:Ncor2 UTSW 5 125020011 missense probably benign 0.14
R6109:Ncor2 UTSW 5 125055846 missense probably damaging 1.00
R6423:Ncor2 UTSW 5 125087902 missense unknown
R6462:Ncor2 UTSW 5 125024172 missense probably damaging 1.00
R6478:Ncor2 UTSW 5 125110005 intron probably benign
Z1088:Ncor2 UTSW 5 125067788 missense unknown
Z1088:Ncor2 UTSW 5 125086840 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTTGGTGATGCTTCCACTG -3'
(R):5'- CCTAAGAAGCTGGGTGAGTTCC -3'

Sequencing Primer
(F):5'- TGGTGGCGGAACCCAGTG -3'
(R):5'- CCTTACAACTTGGGCTAAGGG -3'
Posted On2016-02-04