Incidental Mutation 'R4799:Efnb2'
ID369339
Institutional Source Beutler Lab
Gene Symbol Efnb2
Ensembl Gene ENSMUSG00000001300
Gene Nameephrin B2
SynonymsLERK-5, Epl5, Htk-L, ELF-2, NLERK-1, Eplg5, Lerk5
MMRRC Submission 041997-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4799 (G1)
Quality Score128
Status Validated
Chromosome8
Chromosomal Location8617434-8661242 bp(-) (GRCm38)
Type of Mutationintron (44 bp from exon)
DNA Base Change (assembly) A to T at 8623104 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001319]
PDB Structure
CRYSTAL STRUCTURE OF THE MURINE EPHRIN-B2 ECTODOMAIN [X-RAY DIFFRACTION]
Crystal Structure of the EphB2-ephrinB2 complex [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000001319
SMART Domains Protein: ENSMUSP00000001319
Gene: ENSMUSG00000001300

DomainStartEndE-ValueType
Pfam:Ephrin 32 167 4.6e-53 PFAM
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152698
SMART Domains Protein: ENSMUSP00000116027
Gene: ENSMUSG00000001300

DomainStartEndE-ValueType
Pfam:Ephrin 1 68 1.3e-19 PFAM
transmembrane domain 115 137 N/A INTRINSIC
low complexity region 151 161 N/A INTRINSIC
Meta Mutation Damage Score 0.6328 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (122/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in angiogenesis of both arteries and veins and die by embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b C G 12: 70,169,064 S170C probably damaging Het
Acads T A 5: 115,113,090 T112S probably benign Het
Adgrl1 A G 8: 83,935,573 H1021R probably benign Het
Ago3 A T 4: 126,347,872 probably null Het
Ap5m1 A G 14: 49,081,070 K412E probably benign Het
Arid1b C T 17: 5,339,221 P1681S probably damaging Het
Atxn10 T C 15: 85,376,708 probably null Het
AU040320 A G 4: 126,839,669 T661A probably benign Het
Capn7 T C 14: 31,360,557 I455M probably benign Het
Capzb A G 4: 139,192,999 probably benign Het
Car10 G A 11: 93,578,666 V156I possibly damaging Het
Cbs T A 17: 31,632,852 D59V probably damaging Het
Ccar2 T C 14: 70,139,554 E819G probably damaging Het
Cdc73 T A 1: 143,627,875 Q346L probably benign Het
Cdhr4 T C 9: 107,998,699 probably benign Het
Chd2 A T 7: 73,484,436 M721K possibly damaging Het
Cntnap5b G A 1: 100,358,725 G402R probably benign Het
Cps1 T C 1: 67,142,986 Y120H probably damaging Het
Csf2 T C 11: 54,249,480 D44G probably benign Het
Cubn T A 2: 13,287,024 Q3330L possibly damaging Het
Cubn A G 2: 13,351,058 S1788P probably damaging Het
Cul9 T C 17: 46,500,844 D2486G possibly damaging Het
Cyp2c40 A T 19: 39,773,849 S451R probably damaging Het
Cyp51 T A 5: 4,083,256 T461S probably damaging Het
Cyth1 T C 11: 118,183,942 M164V probably damaging Het
D130043K22Rik T C 13: 24,878,040 I664T probably damaging Het
Ddc T C 11: 11,846,632 probably null Het
Ddx21 A T 10: 62,588,121 D589E probably damaging Het
Dgkb C T 12: 38,114,568 R113C possibly damaging Het
Dglucy A T 12: 100,850,343 M415L probably benign Het
Elp4 T A 2: 105,809,267 Q189L probably damaging Het
Enpp2 T C 15: 54,910,094 N77S probably damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
F2rl1 G A 13: 95,513,969 S135F possibly damaging Het
Fam133b T C 5: 3,557,815 M65T probably damaging Het
Fanca A G 8: 123,288,202 V689A probably damaging Het
Fbxo18 C T 2: 11,755,747 C79Y probably damaging Het
Fbxw7 C T 3: 84,903,861 Q98* probably null Het
Flrt3 T C 2: 140,660,166 N514S probably damaging Het
Foxj3 A T 4: 119,621,660 S438C unknown Het
Gcm2 T C 13: 41,103,494 K260E possibly damaging Het
Gm12863 C T 4: 118,954,488 noncoding transcript Het
Gm5096 C A 18: 87,756,449 A32E probably damaging Het
Gpnmb G T 6: 49,045,483 probably null Het
Gsap C A 5: 21,250,943 N379K probably benign Het
Hsd3b1 T A 3: 98,852,865 Y270F probably benign Het
Il22 C A 10: 118,205,153 R55S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhdc3 T C 17: 46,677,300 R180G possibly damaging Het
Lmbrd1 G A 1: 24,744,975 probably null Het
Lrrcc1 C T 3: 14,536,096 R63* probably null Het
Lyar A G 5: 38,224,779 D35G probably damaging Het
Mbd4 C T 6: 115,845,322 R442Q probably benign Het
Mib2 G T 4: 155,659,772 S144R probably benign Het
Mms22l A T 4: 24,580,052 probably null Het
Mtmr3 G A 11: 4,487,764 H897Y probably benign Het
Muc5b T A 7: 141,847,716 C566* probably null Het
Nap1l4 A T 7: 143,534,463 probably null Het
Ncor2 A T 5: 125,037,060 probably null Het
Ndufa7 T C 17: 33,838,213 probably benign Het
Ndufs1 C A 1: 63,160,949 G268V probably damaging Het
Nfs1 A G 2: 156,134,449 V175A possibly damaging Het
Obsl1 C A 1: 75,489,501 A1528S possibly damaging Het
Olfr1089 C T 2: 86,732,674 probably null Het
Olfr1252 C T 2: 89,721,362 V250I probably benign Het
Olfr372 A G 8: 72,058,094 N138S probably benign Het
Olfr67 A T 7: 103,787,481 F265L possibly damaging Het
Olfr8 T G 10: 78,956,097 D297E probably null Het
Pcdhb8 A G 18: 37,355,653 D128G probably damaging Het
Pkp4 A T 2: 59,342,105 I522F probably damaging Het
Plod3 G A 5: 136,990,800 A398T probably benign Het
Pou4f3 A G 18: 42,395,987 M332V possibly damaging Het
Prox1 A G 1: 190,153,472 F593L probably damaging Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Prss50 A G 9: 110,863,796 D328G probably damaging Het
Psmd6 C T 14: 14,120,126 S71N probably benign Het
Ptprd A G 4: 76,091,532 I764T probably benign Het
Ptprr C T 10: 116,048,218 A60V probably benign Het
Raet1e T A 10: 22,181,300 D174E probably damaging Het
Rbfox2 T C 15: 77,091,818 I308M probably benign Het
Rnf20 G C 4: 49,649,962 probably null Het
Rpap2 A T 5: 107,620,247 H317L probably benign Het
Rsph6a T A 7: 19,065,858 Y471* probably null Het
Sdhb A G 4: 140,977,466 H246R possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Sin3b A C 8: 72,725,643 I126L probably benign Het
Skint2 G A 4: 112,652,108 A363T probably benign Het
Slc22a30 A G 19: 8,344,404 I432T probably benign Het
Slc2a2 G A 3: 28,717,532 probably null Het
Slco1a5 T C 6: 142,248,807 Y370C possibly damaging Het
Sltm A G 9: 70,589,057 H958R probably damaging Het
Smpdl3a C T 10: 57,808,015 H290Y probably damaging Het
Snrnp40 A G 4: 130,362,756 I91M probably damaging Het
Spag9 A T 11: 94,048,516 K90N possibly damaging Het
Spag9 T A 11: 94,048,517 F91I probably damaging Het
Stox1 A C 10: 62,665,737 I348S probably damaging Het
Sult1e1 A G 5: 87,590,168 V18A possibly damaging Het
Syne2 A G 12: 75,899,167 M338V probably benign Het
Tbc1d23 T A 16: 57,192,628 Q327L probably benign Het
Terf2 G T 8: 107,076,675 H425Q probably benign Het
Timd2 A T 11: 46,677,267 Y233* probably null Het
Tmem39a A G 16: 38,591,162 probably benign Het
Trappc10 T C 10: 78,201,590 D793G possibly damaging Het
Ttc30a2 T A 2: 75,977,385 Y261F probably benign Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Unc93a T C 17: 13,120,895 probably null Het
Utrn T C 10: 12,750,069 T123A probably damaging Het
Vmn1r171 T C 7: 23,632,944 I198T probably benign Het
Vmn1r213 T A 13: 23,011,846 S200T probably damaging Het
Vmn2r108 T A 17: 20,462,629 D771V probably damaging Het
Wdr66 C T 5: 123,302,772 H1131Y probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zc3h13 G A 14: 75,339,423 C1657Y probably damaging Het
Zdhhc5 T C 2: 84,693,431 K224E probably damaging Het
Zfp54 T A 17: 21,434,140 Y299N probably damaging Het
Zfp820 A T 17: 21,818,985 L454Q probably benign Het
Zfp960 T A 17: 17,088,436 F471I probably damaging Het
Zswim5 A G 4: 116,972,972 I515V probably benign Het
Zzef1 G T 11: 72,859,623 S919I probably benign Het
Other mutations in Efnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Efnb2 APN 8 8660589 missense probably benign 0.08
IGL02076:Efnb2 APN 8 8660488 missense probably benign
IGL03333:Efnb2 APN 8 8639275 nonsense probably null
IGL03098:Efnb2 UTSW 8 8663420 unclassified probably benign
R1416:Efnb2 UTSW 8 8622329 critical splice donor site probably null
R1760:Efnb2 UTSW 8 8623184 missense possibly damaging 0.90
R1783:Efnb2 UTSW 8 8623237 missense probably damaging 1.00
R4272:Efnb2 UTSW 8 8620698 missense probably damaging 0.99
R4398:Efnb2 UTSW 8 8620832 missense possibly damaging 0.80
R4782:Efnb2 UTSW 8 8623104 intron probably null
R5193:Efnb2 UTSW 8 8623162 missense probably damaging 1.00
R5443:Efnb2 UTSW 8 8620862 missense probably damaging 1.00
R5749:Efnb2 UTSW 8 8639347 missense probably damaging 1.00
R6083:Efnb2 UTSW 8 8622328 splice site probably null
R6266:Efnb2 UTSW 8 8660524 missense probably benign
R6482:Efnb2 UTSW 8 8620637 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTCTTGCTGACCTGAAC -3'
(R):5'- CATTCAGAGAACTTGTGACAAAGAG -3'

Sequencing Primer
(F):5'- CTTGCTGACCTGAACTTTTAGAGAG -3'
(R):5'- GGTTTCAGACATTTCATGTTCATG -3'
Posted On2016-02-04