Incidental Mutation 'R4799:Klhdc3'
ID369393
Institutional Source Beutler Lab
Gene Symbol Klhdc3
Ensembl Gene ENSMUSG00000063576
Gene Namekelch domain containing 3
Synonyms1300011D16Rik, Peas
MMRRC Submission 041997-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.593) question?
Stock #R4799 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46674550-46680930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46677300 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 180 (R180G)
Ref Sequence ENSEMBL: ENSMUSP00000128271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002845] [ENSMUST00000024766] [ENSMUST00000071841] [ENSMUST00000165007]
Predicted Effect probably benign
Transcript: ENSMUST00000002845
SMART Domains Protein: ENSMUSP00000002845
Gene: ENSMUSG00000002768

DomainStartEndE-ValueType
Pfam:MEA1 1 174 1.6e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024766
SMART Domains Protein: ENSMUSP00000024766
Gene: ENSMUSG00000023971

DomainStartEndE-ValueType
Pfam:DUF947 55 219 7.6e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071841
AA Change: R180G

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071743
Gene: ENSMUSG00000063576
AA Change: R180G

DomainStartEndE-ValueType
Pfam:Kelch_1 13 63 1.6e-8 PFAM
Pfam:Kelch_2 13 63 2.2e-9 PFAM
Pfam:Kelch_4 13 65 3.8e-8 PFAM
Pfam:Kelch_6 13 67 9.6e-11 PFAM
Pfam:Kelch_5 73 113 3.1e-8 PFAM
Pfam:Kelch_1 76 117 1.9e-7 PFAM
Pfam:Kelch_6 76 121 1.7e-9 PFAM
Pfam:Kelch_2 77 121 2.1e-8 PFAM
Pfam:Kelch_4 77 125 4.6e-11 PFAM
Pfam:Kelch_3 86 136 1.3e-12 PFAM
Pfam:Kelch_1 127 172 1.5e-10 PFAM
Pfam:Kelch_6 127 173 2e-10 PFAM
Pfam:Kelch_2 127 174 4.7e-14 PFAM
Pfam:Kelch_4 127 177 1.3e-10 PFAM
Pfam:Kelch_2 179 231 2.4e-8 PFAM
Pfam:Kelch_1 180 233 5.8e-9 PFAM
Pfam:Kelch_3 189 247 7.3e-8 PFAM
Pfam:Kelch_5 235 276 1.2e-11 PFAM
Pfam:Kelch_1 238 284 2.7e-8 PFAM
Pfam:Kelch_6 238 293 2.4e-12 PFAM
Pfam:Kelch_3 248 299 4.2e-10 PFAM
low complexity region 322 333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165007
AA Change: R180G

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128271
Gene: ENSMUSG00000063576
AA Change: R180G

DomainStartEndE-ValueType
Pfam:Kelch_1 13 63 9.9e-10 PFAM
Pfam:Kelch_2 13 63 2.2e-9 PFAM
Pfam:Kelch_6 13 66 7.5e-11 PFAM
Pfam:Kelch_4 13 71 1.4e-8 PFAM
Pfam:Kelch_5 73 113 3e-8 PFAM
Pfam:Kelch_1 76 118 2.6e-8 PFAM
Pfam:Kelch_6 76 121 1.1e-10 PFAM
Pfam:Kelch_4 76 126 2e-11 PFAM
Pfam:Kelch_2 77 121 2.1e-8 PFAM
Pfam:Kelch_3 86 136 7.7e-12 PFAM
Pfam:Kelch_1 127 170 1.2e-8 PFAM
Pfam:Kelch_2 127 174 4.7e-14 PFAM
Pfam:Kelch_4 127 177 1.7e-7 PFAM
Pfam:Kelch_2 179 231 2.4e-8 PFAM
Pfam:Kelch_6 179 239 2.5e-9 PFAM
Pfam:Kelch_1 180 232 3.4e-8 PFAM
Pfam:Kelch_3 189 247 5.7e-8 PFAM
Pfam:Kelch_5 235 276 4.3e-10 PFAM
Pfam:Kelch_1 238 285 9.3e-10 PFAM
Pfam:Kelch_4 238 291 9.9e-8 PFAM
Pfam:Kelch_6 238 293 2.5e-12 PFAM
Pfam:Kelch_3 248 299 1.1e-9 PFAM
low complexity region 322 333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.544 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (122/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six repeated kelch motifs that are structurally similar to recombination activating gene 2, a protein involved in the activation of the V(D)J recombination. In mouse, this gene is found to be expressed specifically in testis. Its expression in pachytene spermatocytes is localized to cytoplasma and meiotic chromatin, suggesting that this gene may be involved in meiotic recombination. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b C G 12: 70,169,064 S170C probably damaging Het
Acads T A 5: 115,113,090 T112S probably benign Het
Adgrl1 A G 8: 83,935,573 H1021R probably benign Het
Ago3 A T 4: 126,347,872 probably null Het
Ap5m1 A G 14: 49,081,070 K412E probably benign Het
Arid1b C T 17: 5,339,221 P1681S probably damaging Het
Atxn10 T C 15: 85,376,708 probably null Het
AU040320 A G 4: 126,839,669 T661A probably benign Het
Capn7 T C 14: 31,360,557 I455M probably benign Het
Capzb A G 4: 139,192,999 probably benign Het
Car10 G A 11: 93,578,666 V156I possibly damaging Het
Cbs T A 17: 31,632,852 D59V probably damaging Het
Ccar2 T C 14: 70,139,554 E819G probably damaging Het
Cdc73 T A 1: 143,627,875 Q346L probably benign Het
Cdhr4 T C 9: 107,998,699 probably benign Het
Chd2 A T 7: 73,484,436 M721K possibly damaging Het
Cntnap5b G A 1: 100,358,725 G402R probably benign Het
Cps1 T C 1: 67,142,986 Y120H probably damaging Het
Csf2 T C 11: 54,249,480 D44G probably benign Het
Cubn T A 2: 13,287,024 Q3330L possibly damaging Het
Cubn A G 2: 13,351,058 S1788P probably damaging Het
Cul9 T C 17: 46,500,844 D2486G possibly damaging Het
Cyp2c40 A T 19: 39,773,849 S451R probably damaging Het
Cyp51 T A 5: 4,083,256 T461S probably damaging Het
Cyth1 T C 11: 118,183,942 M164V probably damaging Het
D130043K22Rik T C 13: 24,878,040 I664T probably damaging Het
Ddc T C 11: 11,846,632 probably null Het
Ddx21 A T 10: 62,588,121 D589E probably damaging Het
Dgkb C T 12: 38,114,568 R113C possibly damaging Het
Dglucy A T 12: 100,850,343 M415L probably benign Het
Efnb2 A T 8: 8,623,104 probably null Het
Elp4 T A 2: 105,809,267 Q189L probably damaging Het
Enpp2 T C 15: 54,910,094 N77S probably damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
F2rl1 G A 13: 95,513,969 S135F possibly damaging Het
Fam133b T C 5: 3,557,815 M65T probably damaging Het
Fanca A G 8: 123,288,202 V689A probably damaging Het
Fbxo18 C T 2: 11,755,747 C79Y probably damaging Het
Fbxw7 C T 3: 84,903,861 Q98* probably null Het
Flrt3 T C 2: 140,660,166 N514S probably damaging Het
Foxj3 A T 4: 119,621,660 S438C unknown Het
Gcm2 T C 13: 41,103,494 K260E possibly damaging Het
Gm12863 C T 4: 118,954,488 noncoding transcript Het
Gm5096 C A 18: 87,756,449 A32E probably damaging Het
Gpnmb G T 6: 49,045,483 probably null Het
Gsap C A 5: 21,250,943 N379K probably benign Het
Hsd3b1 T A 3: 98,852,865 Y270F probably benign Het
Il22 C A 10: 118,205,153 R55S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lmbrd1 G A 1: 24,744,975 probably null Het
Lrrcc1 C T 3: 14,536,096 R63* probably null Het
Lyar A G 5: 38,224,779 D35G probably damaging Het
Mbd4 C T 6: 115,845,322 R442Q probably benign Het
Mib2 G T 4: 155,659,772 S144R probably benign Het
Mms22l A T 4: 24,580,052 probably null Het
Mtmr3 G A 11: 4,487,764 H897Y probably benign Het
Muc5b T A 7: 141,847,716 C566* probably null Het
Nap1l4 A T 7: 143,534,463 probably null Het
Ncor2 A T 5: 125,037,060 probably null Het
Ndufa7 T C 17: 33,838,213 probably benign Het
Ndufs1 C A 1: 63,160,949 G268V probably damaging Het
Nfs1 A G 2: 156,134,449 V175A possibly damaging Het
Obsl1 C A 1: 75,489,501 A1528S possibly damaging Het
Olfr1089 C T 2: 86,732,674 probably null Het
Olfr1252 C T 2: 89,721,362 V250I probably benign Het
Olfr372 A G 8: 72,058,094 N138S probably benign Het
Olfr67 A T 7: 103,787,481 F265L possibly damaging Het
Olfr8 T G 10: 78,956,097 D297E probably null Het
Pcdhb8 A G 18: 37,355,653 D128G probably damaging Het
Pkp4 A T 2: 59,342,105 I522F probably damaging Het
Plod3 G A 5: 136,990,800 A398T probably benign Het
Pou4f3 A G 18: 42,395,987 M332V possibly damaging Het
Prox1 A G 1: 190,153,472 F593L probably damaging Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Prss50 A G 9: 110,863,796 D328G probably damaging Het
Psmd6 C T 14: 14,120,126 S71N probably benign Het
Ptprd A G 4: 76,091,532 I764T probably benign Het
Ptprr C T 10: 116,048,218 A60V probably benign Het
Raet1e T A 10: 22,181,300 D174E probably damaging Het
Rbfox2 T C 15: 77,091,818 I308M probably benign Het
Rnf20 G C 4: 49,649,962 probably null Het
Rpap2 A T 5: 107,620,247 H317L probably benign Het
Rsph6a T A 7: 19,065,858 Y471* probably null Het
Sdhb A G 4: 140,977,466 H246R possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Sin3b A C 8: 72,725,643 I126L probably benign Het
Skint2 G A 4: 112,652,108 A363T probably benign Het
Slc22a30 A G 19: 8,344,404 I432T probably benign Het
Slc2a2 G A 3: 28,717,532 probably null Het
Slco1a5 T C 6: 142,248,807 Y370C possibly damaging Het
Sltm A G 9: 70,589,057 H958R probably damaging Het
Smpdl3a C T 10: 57,808,015 H290Y probably damaging Het
Snrnp40 A G 4: 130,362,756 I91M probably damaging Het
Spag9 A T 11: 94,048,516 K90N possibly damaging Het
Spag9 T A 11: 94,048,517 F91I probably damaging Het
Stox1 A C 10: 62,665,737 I348S probably damaging Het
Sult1e1 A G 5: 87,590,168 V18A possibly damaging Het
Syne2 A G 12: 75,899,167 M338V probably benign Het
Tbc1d23 T A 16: 57,192,628 Q327L probably benign Het
Terf2 G T 8: 107,076,675 H425Q probably benign Het
Timd2 A T 11: 46,677,267 Y233* probably null Het
Tmem39a A G 16: 38,591,162 probably benign Het
Trappc10 T C 10: 78,201,590 D793G possibly damaging Het
Ttc30a2 T A 2: 75,977,385 Y261F probably benign Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Unc93a T C 17: 13,120,895 probably null Het
Utrn T C 10: 12,750,069 T123A probably damaging Het
Vmn1r171 T C 7: 23,632,944 I198T probably benign Het
Vmn1r213 T A 13: 23,011,846 S200T probably damaging Het
Vmn2r108 T A 17: 20,462,629 D771V probably damaging Het
Wdr66 C T 5: 123,302,772 H1131Y probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zc3h13 G A 14: 75,339,423 C1657Y probably damaging Het
Zdhhc5 T C 2: 84,693,431 K224E probably damaging Het
Zfp54 T A 17: 21,434,140 Y299N probably damaging Het
Zfp820 A T 17: 21,818,985 L454Q probably benign Het
Zfp960 T A 17: 17,088,436 F471I probably damaging Het
Zswim5 A G 4: 116,972,972 I515V probably benign Het
Zzef1 G T 11: 72,859,623 S919I probably benign Het
Other mutations in Klhdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Klhdc3 APN 17 46677300 missense possibly damaging 0.82
R0667:Klhdc3 UTSW 17 46677225 missense probably benign 0.07
R0960:Klhdc3 UTSW 17 46676518 missense possibly damaging 0.89
R1254:Klhdc3 UTSW 17 46678067 missense probably benign
R1263:Klhdc3 UTSW 17 46676966 missense probably benign 0.00
R1954:Klhdc3 UTSW 17 46677975 missense probably damaging 1.00
R2093:Klhdc3 UTSW 17 46677953 missense probably benign 0.00
R3808:Klhdc3 UTSW 17 46677932 missense possibly damaging 0.89
R3809:Klhdc3 UTSW 17 46677932 missense possibly damaging 0.89
R4409:Klhdc3 UTSW 17 46677018 missense probably damaging 1.00
R5807:Klhdc3 UTSW 17 46677465 missense probably damaging 0.98
R5958:Klhdc3 UTSW 17 46675102 missense probably benign 0.12
R6152:Klhdc3 UTSW 17 46677707 missense probably damaging 1.00
R6295:Klhdc3 UTSW 17 46678046 missense probably benign 0.36
R6521:Klhdc3 UTSW 17 46677761 missense probably benign 0.20
R6851:Klhdc3 UTSW 17 46678292 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACACTCACAGGCTGAATGGC -3'
(R):5'- GACTGCTTTTCCAACGACATC -3'

Sequencing Primer
(F):5'- CTGAATGGCTCCTGCGC -3'
(R):5'- TGCTTTTCCAACGACATCCACAAG -3'
Posted On2016-02-04