Incidental Mutation 'R4799:Pcdhb8'
ID369394
Institutional Source Beutler Lab
Gene Symbol Pcdhb8
Ensembl Gene ENSMUSG00000045876
Gene Nameprotocadherin beta 8
SynonymsPcdhb5C, PcdhbH
MMRRC Submission 041997-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4799 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37355121-37358604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37355653 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 128 (D128G)
Ref Sequence ENSEMBL: ENSMUSP00000054371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051163] [ENSMUST00000115661] [ENSMUST00000192867] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000051163
AA Change: D128G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054371
Gene: ENSMUSG00000045876
AA Change: D128G

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 6.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 9.51e-26 SMART
CA 588 669 5.65e-10 SMART
Pfam:Cadherin_C_2 685 768 1.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192867
SMART Domains Protein: ENSMUSP00000141814
Gene: ENSMUSG00000045876

DomainStartEndE-ValueType
CA 26 104 7e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (122/126)
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b C G 12: 70,169,064 S170C probably damaging Het
Acads T A 5: 115,113,090 T112S probably benign Het
Adgrl1 A G 8: 83,935,573 H1021R probably benign Het
Ago3 A T 4: 126,347,872 probably null Het
Ap5m1 A G 14: 49,081,070 K412E probably benign Het
Arid1b C T 17: 5,339,221 P1681S probably damaging Het
Atxn10 T C 15: 85,376,708 probably null Het
AU040320 A G 4: 126,839,669 T661A probably benign Het
Capn7 T C 14: 31,360,557 I455M probably benign Het
Capzb A G 4: 139,192,999 probably benign Het
Car10 G A 11: 93,578,666 V156I possibly damaging Het
Cbs T A 17: 31,632,852 D59V probably damaging Het
Ccar2 T C 14: 70,139,554 E819G probably damaging Het
Cdc73 T A 1: 143,627,875 Q346L probably benign Het
Cdhr4 T C 9: 107,998,699 probably benign Het
Chd2 A T 7: 73,484,436 M721K possibly damaging Het
Cntnap5b G A 1: 100,358,725 G402R probably benign Het
Cps1 T C 1: 67,142,986 Y120H probably damaging Het
Csf2 T C 11: 54,249,480 D44G probably benign Het
Cubn T A 2: 13,287,024 Q3330L possibly damaging Het
Cubn A G 2: 13,351,058 S1788P probably damaging Het
Cul9 T C 17: 46,500,844 D2486G possibly damaging Het
Cyp2c40 A T 19: 39,773,849 S451R probably damaging Het
Cyp51 T A 5: 4,083,256 T461S probably damaging Het
Cyth1 T C 11: 118,183,942 M164V probably damaging Het
D130043K22Rik T C 13: 24,878,040 I664T probably damaging Het
Ddc T C 11: 11,846,632 probably null Het
Ddx21 A T 10: 62,588,121 D589E probably damaging Het
Dgkb C T 12: 38,114,568 R113C possibly damaging Het
Dglucy A T 12: 100,850,343 M415L probably benign Het
Efnb2 A T 8: 8,623,104 probably null Het
Elp4 T A 2: 105,809,267 Q189L probably damaging Het
Enpp2 T C 15: 54,910,094 N77S probably damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
F2rl1 G A 13: 95,513,969 S135F possibly damaging Het
Fam133b T C 5: 3,557,815 M65T probably damaging Het
Fanca A G 8: 123,288,202 V689A probably damaging Het
Fbxo18 C T 2: 11,755,747 C79Y probably damaging Het
Fbxw7 C T 3: 84,903,861 Q98* probably null Het
Flrt3 T C 2: 140,660,166 N514S probably damaging Het
Foxj3 A T 4: 119,621,660 S438C unknown Het
Gcm2 T C 13: 41,103,494 K260E possibly damaging Het
Gm12863 C T 4: 118,954,488 noncoding transcript Het
Gm5096 C A 18: 87,756,449 A32E probably damaging Het
Gpnmb G T 6: 49,045,483 probably null Het
Gsap C A 5: 21,250,943 N379K probably benign Het
Hsd3b1 T A 3: 98,852,865 Y270F probably benign Het
Il22 C A 10: 118,205,153 R55S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhdc3 T C 17: 46,677,300 R180G possibly damaging Het
Lmbrd1 G A 1: 24,744,975 probably null Het
Lrrcc1 C T 3: 14,536,096 R63* probably null Het
Lyar A G 5: 38,224,779 D35G probably damaging Het
Mbd4 C T 6: 115,845,322 R442Q probably benign Het
Mib2 G T 4: 155,659,772 S144R probably benign Het
Mms22l A T 4: 24,580,052 probably null Het
Mtmr3 G A 11: 4,487,764 H897Y probably benign Het
Muc5b T A 7: 141,847,716 C566* probably null Het
Nap1l4 A T 7: 143,534,463 probably null Het
Ncor2 A T 5: 125,037,060 probably null Het
Ndufa7 T C 17: 33,838,213 probably benign Het
Ndufs1 C A 1: 63,160,949 G268V probably damaging Het
Nfs1 A G 2: 156,134,449 V175A possibly damaging Het
Obsl1 C A 1: 75,489,501 A1528S possibly damaging Het
Olfr1089 C T 2: 86,732,674 probably null Het
Olfr1252 C T 2: 89,721,362 V250I probably benign Het
Olfr372 A G 8: 72,058,094 N138S probably benign Het
Olfr67 A T 7: 103,787,481 F265L possibly damaging Het
Olfr8 T G 10: 78,956,097 D297E probably null Het
Pkp4 A T 2: 59,342,105 I522F probably damaging Het
Plod3 G A 5: 136,990,800 A398T probably benign Het
Pou4f3 A G 18: 42,395,987 M332V possibly damaging Het
Prox1 A G 1: 190,153,472 F593L probably damaging Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Prss50 A G 9: 110,863,796 D328G probably damaging Het
Psmd6 C T 14: 14,120,126 S71N probably benign Het
Ptprd A G 4: 76,091,532 I764T probably benign Het
Ptprr C T 10: 116,048,218 A60V probably benign Het
Raet1e T A 10: 22,181,300 D174E probably damaging Het
Rbfox2 T C 15: 77,091,818 I308M probably benign Het
Rnf20 G C 4: 49,649,962 probably null Het
Rpap2 A T 5: 107,620,247 H317L probably benign Het
Rsph6a T A 7: 19,065,858 Y471* probably null Het
Sdhb A G 4: 140,977,466 H246R possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Sin3b A C 8: 72,725,643 I126L probably benign Het
Skint2 G A 4: 112,652,108 A363T probably benign Het
Slc22a30 A G 19: 8,344,404 I432T probably benign Het
Slc2a2 G A 3: 28,717,532 probably null Het
Slco1a5 T C 6: 142,248,807 Y370C possibly damaging Het
Sltm A G 9: 70,589,057 H958R probably damaging Het
Smpdl3a C T 10: 57,808,015 H290Y probably damaging Het
Snrnp40 A G 4: 130,362,756 I91M probably damaging Het
Spag9 A T 11: 94,048,516 K90N possibly damaging Het
Spag9 T A 11: 94,048,517 F91I probably damaging Het
Stox1 A C 10: 62,665,737 I348S probably damaging Het
Sult1e1 A G 5: 87,590,168 V18A possibly damaging Het
Syne2 A G 12: 75,899,167 M338V probably benign Het
Tbc1d23 T A 16: 57,192,628 Q327L probably benign Het
Terf2 G T 8: 107,076,675 H425Q probably benign Het
Timd2 A T 11: 46,677,267 Y233* probably null Het
Tmem39a A G 16: 38,591,162 probably benign Het
Trappc10 T C 10: 78,201,590 D793G possibly damaging Het
Ttc30a2 T A 2: 75,977,385 Y261F probably benign Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Unc93a T C 17: 13,120,895 probably null Het
Utrn T C 10: 12,750,069 T123A probably damaging Het
Vmn1r171 T C 7: 23,632,944 I198T probably benign Het
Vmn1r213 T A 13: 23,011,846 S200T probably damaging Het
Vmn2r108 T A 17: 20,462,629 D771V probably damaging Het
Wdr66 C T 5: 123,302,772 H1131Y probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zc3h13 G A 14: 75,339,423 C1657Y probably damaging Het
Zdhhc5 T C 2: 84,693,431 K224E probably damaging Het
Zfp54 T A 17: 21,434,140 Y299N probably damaging Het
Zfp820 A T 17: 21,818,985 L454Q probably benign Het
Zfp960 T A 17: 17,088,436 F471I probably damaging Het
Zswim5 A G 4: 116,972,972 I515V probably benign Het
Zzef1 G T 11: 72,859,623 S919I probably benign Het
Other mutations in Pcdhb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Pcdhb8 APN 18 37355473 missense probably benign 0.00
IGL00574:Pcdhb8 APN 18 37356370 missense probably damaging 1.00
IGL00960:Pcdhb8 APN 18 37355973 missense probably benign 0.28
IGL01103:Pcdhb8 APN 18 37357200 missense probably damaging 1.00
IGL01330:Pcdhb8 APN 18 37357578 missense probably benign 0.12
IGL01413:Pcdhb8 APN 18 37355976 missense probably damaging 1.00
IGL01418:Pcdhb8 APN 18 37355976 missense probably damaging 1.00
IGL01608:Pcdhb8 APN 18 37356925 missense probably damaging 1.00
IGL02212:Pcdhb8 APN 18 37356412 missense possibly damaging 0.95
IGL02582:Pcdhb8 APN 18 37355374 missense possibly damaging 0.79
IGL02607:Pcdhb8 APN 18 37357581 missense probably benign 0.00
IGL02882:Pcdhb8 APN 18 37356223 missense possibly damaging 0.95
IGL03005:Pcdhb8 APN 18 37357534 missense probably damaging 1.00
IGL03108:Pcdhb8 APN 18 37357246 missense probably damaging 1.00
R0104:Pcdhb8 UTSW 18 37355665 missense probably benign 0.01
R0490:Pcdhb8 UTSW 18 37356780 missense probably damaging 1.00
R0617:Pcdhb8 UTSW 18 37357047 missense probably benign 0.02
R1168:Pcdhb8 UTSW 18 37356727 missense probably benign
R1189:Pcdhb8 UTSW 18 37356567 nonsense probably null
R1232:Pcdhb8 UTSW 18 37355775 missense probably benign 0.28
R1503:Pcdhb8 UTSW 18 37356519 missense probably damaging 1.00
R1576:Pcdhb8 UTSW 18 37356703 missense probably damaging 1.00
R1731:Pcdhb8 UTSW 18 37355838 missense probably damaging 1.00
R1908:Pcdhb8 UTSW 18 37355962 missense possibly damaging 0.84
R1909:Pcdhb8 UTSW 18 37355962 missense possibly damaging 0.84
R2215:Pcdhb8 UTSW 18 37357074 missense probably damaging 0.98
R3080:Pcdhb8 UTSW 18 37356166 missense probably damaging 1.00
R4394:Pcdhb8 UTSW 18 37356882 missense probably damaging 1.00
R4845:Pcdhb8 UTSW 18 37356718 missense probably benign 0.43
R4879:Pcdhb8 UTSW 18 37356166 missense probably damaging 1.00
R4941:Pcdhb8 UTSW 18 37356006 missense probably benign 0.03
R5086:Pcdhb8 UTSW 18 37356106 missense probably damaging 1.00
R5416:Pcdhb8 UTSW 18 37356955 missense probably damaging 1.00
R5774:Pcdhb8 UTSW 18 37356685 missense probably damaging 1.00
R5898:Pcdhb8 UTSW 18 37357484 missense possibly damaging 0.92
R5935:Pcdhb8 UTSW 18 37356190 missense probably damaging 1.00
R6191:Pcdhb8 UTSW 18 37356226 missense probably benign
R6228:Pcdhb8 UTSW 18 37356984 missense probably benign 0.05
R6245:Pcdhb8 UTSW 18 37357169 missense possibly damaging 0.80
R6397:Pcdhb8 UTSW 18 37355463 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGGAACTGACCACTAGAG -3'
(R):5'- TTCCTGTCATCTGAGCGACTG -3'

Sequencing Primer
(F):5'- CTAGAGGGGCACGAATCCATC -3'
(R):5'- CTGTCATCTGAGCGACTGAGAGTAAC -3'
Posted On2016-02-04