Incidental Mutation 'R0419:Adamts5'
ID36952
Institutional Source Beutler Lab
Gene Symbol Adamts5
Ensembl Gene ENSMUSG00000022894
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Synonyms9530092O11Rik, ADAM-TS5
MMRRC Submission 038621-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R0419 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location85856173-85901828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85866642 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 735 (I735V)
Ref Sequence ENSEMBL: ENSMUSP00000023611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023611]
Predicted Effect probably benign
Transcript: ENSMUST00000023611
AA Change: I735V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: I735V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 182 9.1e-18 PFAM
low complexity region 226 232 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 2.1e-16 PFAM
Pfam:Reprolysin_4 265 472 4.8e-14 PFAM
Pfam:Reprolysin 267 476 4.6e-26 PFAM
Pfam:Reprolysin_2 286 466 3.7e-13 PFAM
Pfam:Reprolysin_3 288 421 6.9e-17 PFAM
Blast:ACR 477 555 4e-15 BLAST
low complexity region 556 566 N/A INTRINSIC
TSP1 570 622 6.04e-13 SMART
Pfam:ADAM_spacer1 732 852 1.7e-35 PFAM
TSP1 878 926 7.12e-2 SMART
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,842 probably benign Het
2210010C04Rik T C 6: 41,034,347 N34D probably benign Het
5730507C01Rik A T 12: 18,533,423 R161S possibly damaging Het
Arid1a G T 4: 133,681,124 P2024Q unknown Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
B3galt4 T C 17: 33,950,790 Y158C probably damaging Het
BC049715 A G 6: 136,840,145 T128A possibly damaging Het
Btaf1 T A 19: 36,945,229 I11N probably damaging Het
Cfb T C 17: 34,858,509 I496V probably damaging Het
Chd8 A T 14: 52,204,060 H858Q probably benign Het
Chrne T C 11: 70,615,723 I324V probably benign Het
Clec14a T C 12: 58,267,665 I390M probably damaging Het
Cpsf3 A G 12: 21,297,799 Y207C probably damaging Het
Cubn A C 2: 13,469,763 I410S possibly damaging Het
Cubn T A 2: 13,469,764 I410F possibly damaging Het
Dlc1 T C 8: 36,583,586 E997G possibly damaging Het
Emilin1 G T 5: 30,915,022 V71F probably damaging Het
Esrp2 T C 8: 106,134,675 E164G probably damaging Het
Fars2 A G 13: 36,537,311 T410A probably benign Het
Fat3 A G 9: 15,992,256 V2981A probably damaging Het
Fkbp15 G A 4: 62,326,136 T472I probably benign Het
Gm6871 A G 7: 41,573,445 V73A probably benign Het
Gnl2 T G 4: 125,053,527 S647R probably benign Het
Grb10 T C 11: 11,934,207 I500V possibly damaging Het
Herc1 T C 9: 66,446,074 probably benign Het
Iqgap2 A C 13: 95,689,699 probably null Het
Kcnu1 A T 8: 25,937,618 N321I probably benign Het
Kif23 G A 9: 61,926,405 R519* probably null Het
Klhl1 C T 14: 96,381,789 R224Q probably benign Het
Lama1 T C 17: 67,791,610 probably null Het
Lamp3 T C 16: 19,673,552 Y314C probably damaging Het
Lamtor5 C A 3: 107,281,911 R88S probably damaging Het
Nbea G T 3: 55,819,294 A2088E probably benign Het
Neo1 A G 9: 58,990,180 probably benign Het
Ntn4 A T 10: 93,682,429 R199S probably benign Het
Olfr1020 A T 2: 85,849,967 R172* probably null Het
Plekho2 A G 9: 65,557,052 S172P possibly damaging Het
Pmp2 T C 3: 10,180,763 Y129C probably damaging Het
Ralgapa2 A T 2: 146,428,672 M578K possibly damaging Het
Ranbp3 C T 17: 56,708,219 T307M possibly damaging Het
Serpinb11 G A 1: 107,376,860 W185* probably null Het
Setdb2 A T 14: 59,406,744 probably null Het
Sirpb1b A T 3: 15,548,596 V75E probably damaging Het
Slc13a1 A T 6: 24,100,293 L397Q probably damaging Het
Slc19a1 T A 10: 77,042,908 I355N probably damaging Het
Slc51a T A 16: 32,476,436 I275F possibly damaging Het
Spink14 T C 18: 44,031,867 S84P probably damaging Het
Stx2 A G 5: 128,993,577 probably benign Het
Tgfbi G T 13: 56,632,193 probably benign Het
Tshr T A 12: 91,537,869 M527K probably damaging Het
Upb1 T C 10: 75,412,883 V79A probably damaging Het
Zdhhc5 A T 2: 84,691,243 probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp280d T C 9: 72,312,237 V32A probably benign Het
Other mutations in Adamts5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Adamts5 APN 16 85899834 missense probably damaging 1.00
IGL01070:Adamts5 APN 16 85863133 missense probably damaging 1.00
IGL01321:Adamts5 APN 16 85899475 missense probably benign 0.03
IGL01616:Adamts5 APN 16 85887814 splice site probably null
IGL02551:Adamts5 APN 16 85870038 missense possibly damaging 0.71
IGL03263:Adamts5 APN 16 85869942 missense probably damaging 0.99
IGL03295:Adamts5 APN 16 85877945 missense probably damaging 1.00
IGL03393:Adamts5 APN 16 85868195 missense probably damaging 0.99
IGL03403:Adamts5 APN 16 85863014 missense probably damaging 0.97
R0414:Adamts5 UTSW 16 85877906 missense probably damaging 1.00
R0539:Adamts5 UTSW 16 85868692 missense probably damaging 1.00
R0570:Adamts5 UTSW 16 85899247 missense probably damaging 1.00
R0574:Adamts5 UTSW 16 85899484 missense probably damaging 0.99
R0669:Adamts5 UTSW 16 85899726 missense probably benign 0.45
R1454:Adamts5 UTSW 16 85869993 missense possibly damaging 0.88
R1498:Adamts5 UTSW 16 85900102 missense possibly damaging 0.63
R1729:Adamts5 UTSW 16 85877915 nonsense probably null
R1753:Adamts5 UTSW 16 85899352 missense probably damaging 1.00
R1784:Adamts5 UTSW 16 85877915 nonsense probably null
R1906:Adamts5 UTSW 16 85868685 nonsense probably null
R1946:Adamts5 UTSW 16 85899243 missense probably damaging 1.00
R2180:Adamts5 UTSW 16 85887924 missense probably damaging 1.00
R2223:Adamts5 UTSW 16 85899306 missense probably damaging 1.00
R2366:Adamts5 UTSW 16 85862758 missense probably damaging 1.00
R3889:Adamts5 UTSW 16 85868121 missense probably damaging 1.00
R4214:Adamts5 UTSW 16 85868643 missense probably damaging 1.00
R4909:Adamts5 UTSW 16 85900066 nonsense probably null
R5119:Adamts5 UTSW 16 85899578 missense probably benign 0.00
R5230:Adamts5 UTSW 16 85870068 missense probably damaging 0.97
R5452:Adamts5 UTSW 16 85869912 critical splice donor site probably null
R5652:Adamts5 UTSW 16 85899268 missense probably damaging 1.00
R5831:Adamts5 UTSW 16 85868118 missense probably damaging 1.00
R6045:Adamts5 UTSW 16 85899300 missense probably damaging 0.99
R6259:Adamts5 UTSW 16 85899753 missense probably benign 0.03
R6384:Adamts5 UTSW 16 85862828 missense probably benign 0.00
R6724:Adamts5 UTSW 16 85868557 missense probably benign 0.06
R6829:Adamts5 UTSW 16 85870071 missense possibly damaging 0.52
R7066:Adamts5 UTSW 16 85862764 missense probably damaging 1.00
R7256:Adamts5 UTSW 16 85863035 missense probably damaging 1.00
R7293:Adamts5 UTSW 16 85899945 missense probably benign 0.10
R7298:Adamts5 UTSW 16 85899918 missense probably benign 0.35
R7384:Adamts5 UTSW 16 85899826 missense probably benign 0.02
R7452:Adamts5 UTSW 16 85877981 missense probably benign 0.00
X0062:Adamts5 UTSW 16 85863157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGCCACAGAGCCCTTGTCATC -3'
(R):5'- GAACCATTCTTGAGCCCAGATATCCC -3'

Sequencing Primer
(F):5'- ACAGAGCCCTTGTCATCTCTTC -3'
(R):5'- GAGCCCAGATATCCCTTTTGC -3'
Posted On2013-05-09