Incidental Mutation 'R4812:Wnk1'
ID369540
Institutional Source Beutler Lab
Gene Symbol Wnk1
Ensembl Gene ENSMUSG00000045962
Gene NameWNK lysine deficient protein kinase 1
Synonyms6430573H23Rik, Hsn2, EG406236, Prkwnk1
MMRRC Submission 042431-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4812 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119923969-120038672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119952771 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 850 (V850I)
Ref Sequence ENSEMBL: ENSMUSP00000086019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060043] [ENSMUST00000088644] [ENSMUST00000088646] [ENSMUST00000160686] [ENSMUST00000177761] [ENSMUST00000203030]
Predicted Effect probably benign
Transcript: ENSMUST00000060043
AA Change: V1004I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000063001
Gene: ENSMUSG00000045962
AA Change: V1004I

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.5e-44 PFAM
Pfam:Pkinase 221 479 4.4e-58 PFAM
Pfam:OSR1_C 500 537 2e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 865 876 N/A INTRINSIC
low complexity region 1018 1028 N/A INTRINSIC
low complexity region 1042 1058 N/A INTRINSIC
internal_repeat_1 1136 1178 2.15e-5 PROSPERO
low complexity region 1289 1305 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1398 1428 N/A INTRINSIC
low complexity region 1429 1454 N/A INTRINSIC
low complexity region 1496 1515 N/A INTRINSIC
low complexity region 1542 1556 N/A INTRINSIC
low complexity region 1586 1609 N/A INTRINSIC
low complexity region 1670 1691 N/A INTRINSIC
low complexity region 1698 1712 N/A INTRINSIC
low complexity region 1738 1764 N/A INTRINSIC
low complexity region 1882 1900 N/A INTRINSIC
coiled coil region 2065 2092 N/A INTRINSIC
low complexity region 2103 2114 N/A INTRINSIC
low complexity region 2116 2140 N/A INTRINSIC
low complexity region 2208 2232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088644
AA Change: V1262I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000086017
Gene: ENSMUSG00000045962
AA Change: V1262I

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 5.5e-44 PFAM
Pfam:Pkinase 221 479 4.3e-56 PFAM
Pfam:OSR1_C 500 537 1.9e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
low complexity region 1050 1063 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1146 1158 N/A INTRINSIC
low complexity region 1276 1286 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
internal_repeat_1 1394 1436 2.19e-5 PROSPERO
low complexity region 1547 1563 N/A INTRINSIC
low complexity region 1603 1615 N/A INTRINSIC
low complexity region 1637 1654 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
low complexity region 1687 1712 N/A INTRINSIC
low complexity region 1754 1773 N/A INTRINSIC
low complexity region 1800 1814 N/A INTRINSIC
low complexity region 1844 1867 N/A INTRINSIC
low complexity region 1928 1949 N/A INTRINSIC
low complexity region 1956 1970 N/A INTRINSIC
low complexity region 1996 2022 N/A INTRINSIC
low complexity region 2140 2158 N/A INTRINSIC
coiled coil region 2323 2350 N/A INTRINSIC
low complexity region 2361 2372 N/A INTRINSIC
low complexity region 2374 2398 N/A INTRINSIC
low complexity region 2466 2490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088646
AA Change: V850I

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000086019
Gene: ENSMUSG00000045962
AA Change: V850I

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.3e-44 PFAM
Pfam:Pkinase 221 479 4e-58 PFAM
Pfam:OSR1_C 500 537 1.8e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 864 874 N/A INTRINSIC
low complexity region 888 904 N/A INTRINSIC
internal_repeat_1 982 1024 7.56e-6 PROSPERO
low complexity region 1135 1151 N/A INTRINSIC
low complexity region 1191 1203 N/A INTRINSIC
low complexity region 1225 1242 N/A INTRINSIC
low complexity region 1244 1274 N/A INTRINSIC
low complexity region 1275 1300 N/A INTRINSIC
low complexity region 1342 1361 N/A INTRINSIC
low complexity region 1388 1402 N/A INTRINSIC
low complexity region 1432 1455 N/A INTRINSIC
low complexity region 1516 1537 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1584 1610 N/A INTRINSIC
low complexity region 1700 1718 N/A INTRINSIC
coiled coil region 1883 1910 N/A INTRINSIC
low complexity region 1921 1932 N/A INTRINSIC
low complexity region 1934 1958 N/A INTRINSIC
low complexity region 2026 2050 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159397
Predicted Effect unknown
Transcript: ENSMUST00000159785
AA Change: V144I
SMART Domains Protein: ENSMUSP00000124905
Gene: ENSMUSG00000045962
AA Change: V144I

DomainStartEndE-ValueType
low complexity region 159 169 N/A INTRINSIC
low complexity region 183 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160686
SMART Domains Protein: ENSMUSP00000137334
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 102 115 N/A INTRINSIC
low complexity region 119 128 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160769
Predicted Effect probably benign
Transcript: ENSMUST00000161048
SMART Domains Protein: ENSMUSP00000125345
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
Blast:S_TKc 2 68 3e-34 BLAST
SCOP:d1phk__ 3 70 2e-7 SMART
Pfam:OSR1_C 89 126 9.5e-21 PFAM
coiled coil region 151 185 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161185
Predicted Effect probably benign
Transcript: ENSMUST00000161802
SMART Domains Protein: ENSMUSP00000124724
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162368
SMART Domains Protein: ENSMUSP00000125383
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 83 95 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162541
SMART Domains Protein: ENSMUSP00000125193
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 63 84 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
low complexity region 131 157 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177761
SMART Domains Protein: ENSMUSP00000136777
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.7e-44 PFAM
Pfam:Pkinase 221 479 5.1e-58 PFAM
Pfam:OSR1_C 500 537 2.2e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
low complexity region 828 839 N/A INTRINSIC
low complexity region 1005 1021 N/A INTRINSIC
low complexity region 1136 1149 N/A INTRINSIC
low complexity region 1153 1162 N/A INTRINSIC
low complexity region 1232 1244 N/A INTRINSIC
low complexity region 1291 1307 N/A INTRINSIC
internal_repeat_1 1385 1427 1.91e-5 PROSPERO
low complexity region 1538 1554 N/A INTRINSIC
low complexity region 1594 1606 N/A INTRINSIC
low complexity region 1628 1645 N/A INTRINSIC
low complexity region 1647 1677 N/A INTRINSIC
low complexity region 1678 1703 N/A INTRINSIC
low complexity region 1745 1764 N/A INTRINSIC
low complexity region 1791 1805 N/A INTRINSIC
low complexity region 1835 1858 N/A INTRINSIC
low complexity region 1919 1940 N/A INTRINSIC
low complexity region 1947 1961 N/A INTRINSIC
low complexity region 1987 2013 N/A INTRINSIC
low complexity region 2131 2149 N/A INTRINSIC
coiled coil region 2314 2341 N/A INTRINSIC
low complexity region 2352 2363 N/A INTRINSIC
low complexity region 2365 2389 N/A INTRINSIC
low complexity region 2457 2481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203030
SMART Domains Protein: ENSMUSP00000145304
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 4.1e-44 PFAM
Pfam:Pkinase 221 479 3.2e-56 PFAM
Pfam:OSR1_C 500 537 1.5e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 793 809 N/A INTRINSIC
internal_repeat_1 887 929 5.8e-6 PROSPERO
low complexity region 1040 1056 N/A INTRINSIC
low complexity region 1096 1108 N/A INTRINSIC
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1149 1179 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1247 1266 N/A INTRINSIC
low complexity region 1293 1307 N/A INTRINSIC
low complexity region 1337 1360 N/A INTRINSIC
low complexity region 1421 1442 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1489 1515 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
coiled coil region 1816 1843 N/A INTRINSIC
low complexity region 1854 1865 N/A INTRINSIC
low complexity region 1867 1891 N/A INTRINSIC
low complexity region 1959 1983 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204207
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (124/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK subfamily of serine/threonine protein kinases. The encoded protein may be a key regulator of blood pressure by controlling the transport of sodium and chloride ions. Mutations in this gene have been associated with pseudohypoaldosteronism type II and hereditary sensory neuropathy type II. Alternatively spliced transcript variants encoding different isoforms have been described but the full-length nature of all of them has yet to be determined.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die before birth, whereas heterozygotes survive and exhibit decreased blood pressure. Mice homozygous for an allele that does not produce the kidney isoform exhibit a slight increase in systemic arterial diastolic blood pressure and reduced sensitivity to amiloride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik C T 3: 40,521,484 noncoding transcript Het
2410089E03Rik T G 15: 8,201,123 probably null Het
Abca5 T C 11: 110,301,821 D681G probably damaging Het
Actl11 T C 9: 107,931,130 V884A probably damaging Het
Akr1c14 G A 13: 4,079,165 V187M probably damaging Het
Apbb1 A T 7: 105,574,025 N126K probably damaging Het
Armc4 T G 18: 7,288,634 T78P possibly damaging Het
Bmt2 G T 6: 13,677,800 R12S unknown Het
Btrc G A 19: 45,423,164 C9Y possibly damaging Het
C5ar1 A C 7: 16,248,333 probably null Het
C8a C T 4: 104,862,591 probably null Het
Cabin1 A G 10: 75,646,594 S2172P possibly damaging Het
Calcoco2 T C 11: 96,107,450 D49G probably damaging Het
Camta1 C T 4: 151,131,542 D974N probably null Het
Car6 T C 4: 150,197,415 E47G probably damaging Het
Ccdc105 T C 10: 78,749,216 H262R probably benign Het
Ccnd3 G A 17: 47,597,580 probably null Het
Celf5 A T 10: 81,470,739 V30E probably damaging Het
Cfap46 T A 7: 139,636,000 D1513V probably damaging Het
Cinp T C 12: 110,879,740 Y84C probably damaging Het
Cnih1 A G 14: 46,776,544 I154T probably damaging Het
Col15a1 C T 4: 47,262,479 P511L possibly damaging Het
Col4a4 C T 1: 82,462,153 V1364M unknown Het
Crtam A G 9: 40,984,325 L38P probably damaging Het
Ctnna1 T A 18: 35,239,477 V495D probably damaging Het
Cubn T C 2: 13,459,076 Y606C probably damaging Het
Cyp4f16 C T 17: 32,546,678 A345V probably null Het
Dctn1 A T 6: 83,189,937 M160L probably benign Het
Dip2c T A 13: 9,637,130 C366* probably null Het
Dnajc2 G A 5: 21,763,486 S401L probably benign Het
Dnmt3l A G 10: 78,057,294 I302V probably benign Het
Dvl2 T C 11: 70,011,293 probably benign Het
Edn1 T G 13: 42,303,640 S50A probably benign Het
Efhc1 A T 1: 20,990,647 R636W probably damaging Het
Epg5 T A 18: 77,979,184 H1047Q probably benign Het
Etv1 T G 12: 38,861,288 V371G probably damaging Het
Fam71e2 G A 7: 4,759,072 T295M probably damaging Het
Fap T A 2: 62,519,021 I475F probably damaging Het
Fbxw15 T C 9: 109,559,922 I140V probably benign Het
Fer A G 17: 63,934,297 T311A probably benign Het
Fh1 A G 1: 175,601,459 W497R probably damaging Het
Flot2 T A 11: 78,053,365 L45Q probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fmnl1 T C 11: 103,198,564 probably benign Het
Ggta1 C T 2: 35,402,723 V203I probably benign Het
Gm19345 C T 7: 19,857,873 V204M probably damaging Het
Gm4204 T A 1: 135,232,489 noncoding transcript Het
Gm6124 C G 7: 39,222,895 noncoding transcript Het
Gprin3 T A 6: 59,353,365 K652N possibly damaging Het
Gucy1b2 T C 14: 62,415,897 probably null Het
Hace1 C A 10: 45,686,603 A738E probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hnrnpdl T C 5: 100,036,472 probably benign Het
Hyou1 T C 9: 44,387,121 probably benign Het
Ifi44l G A 3: 151,759,699 A138V probably benign Het
Igkv16-104 A T 6: 68,425,845 I41F possibly damaging Het
Ints7 T A 1: 191,594,430 D171E possibly damaging Het
Kmt2a A T 9: 44,831,354 probably benign Het
Kmt2e T C 5: 23,502,587 V1716A possibly damaging Het
Krtap5-1 G A 7: 142,296,891 S60F unknown Het
Lama4 G A 10: 39,072,769 V843I probably benign Het
Laptm5 A G 4: 130,913,438 probably null Het
Lbhd1 G A 19: 8,889,174 A193T probably damaging Het
Lce3f C T 3: 92,992,940 P23S unknown Het
Lrmp G A 6: 145,148,011 G120S probably damaging Het
Mecom A C 3: 30,140,368 M1R probably null Het
Mindy4 A C 6: 55,279,103 T531P possibly damaging Het
Mrpl3 A G 9: 105,073,824 N263S probably damaging Het
Myo18b T C 5: 112,809,718 K1460E possibly damaging Het
Myof A G 19: 37,916,559 Y852H probably damaging Het
Nefl T G 14: 68,084,285 V108G probably damaging Het
Nid1 T A 13: 13,506,468 L1061* probably null Het
Nim1k T A 13: 119,712,384 M325L probably benign Het
Nlrp1c-ps T C 11: 71,252,305 noncoding transcript Het
Npsr1 C T 9: 24,289,956 T59I probably damaging Het
Nr2c1 A G 10: 94,188,252 T440A probably benign Het
Nup160 C T 2: 90,725,691 T1245I probably damaging Het
Nup88 T A 11: 70,965,726 T194S probably damaging Het
Oas3 A G 5: 120,761,147 probably benign Het
Olfr1129 A G 2: 87,575,743 I220V probably benign Het
Olfr1274-ps T A 2: 90,401,096 M145K probably benign Het
Olfr1393 T A 11: 49,280,457 I103K possibly damaging Het
Opn1sw A T 6: 29,378,039 M252K probably damaging Het
Oprm1 T G 10: 6,832,698 probably benign Het
Pcdha2 T A 18: 36,939,808 V164E probably benign Het
Pclo A G 5: 14,540,025 T780A unknown Het
Pcnx2 T A 8: 125,865,939 Q762L probably benign Het
Pcyt2 A T 11: 120,614,425 probably benign Het
Pdpr A G 8: 111,116,717 N294D probably benign Het
Perm1 T A 4: 156,218,736 V579E possibly damaging Het
Pgk2 T A 17: 40,207,390 K382N possibly damaging Het
Plcb4 T A 2: 136,007,881 L205Q probably damaging Het
Plekha3 C T 2: 76,686,631 T109I probably damaging Het
Pnn T A 12: 59,071,618 V329E possibly damaging Het
Ptpn13 A G 5: 103,523,615 I469M probably benign Het
Rapgef3 A G 15: 97,753,803 V603A probably benign Het
Rbms1 C T 2: 60,792,769 V75I possibly damaging Het
Rbp3 T A 14: 33,954,774 D226E probably damaging Het
Robo2 A T 16: 73,916,288 N1189K probably benign Het
Rragd A G 4: 33,018,766 T270A probably benign Het
Rxfp1 T A 3: 79,650,582 T530S probably benign Het
Ryr3 T C 2: 112,912,236 E479G probably damaging Het
Scd2 A T 19: 44,301,402 I279F probably damaging Het
Sh3d19 A T 3: 86,123,767 D746V probably damaging Het
Shroom4 A G X: 6,624,126 K1133E probably benign Het
Sirpb1c A G 3: 15,833,222 V151A probably damaging Het
Slc26a2 A T 18: 61,202,021 I120N probably damaging Het
Slco1a1 A G 6: 141,918,593 S494P probably damaging Het
Srebf2 A T 15: 82,203,825 T1061S probably damaging Het
Sspo T C 6: 48,490,510 L4202P probably benign Het
Synj2 G A 17: 6,010,664 G215E probably damaging Het
Tbc1d19 T C 5: 53,809,806 V16A probably damaging Het
Tiparp T C 3: 65,552,769 I495T possibly damaging Het
Tipin A G 9: 64,304,412 H260R probably benign Het
Tle1 A G 4: 72,145,354 S221P probably damaging Het
Tmem94 T A 11: 115,796,112 L1101* probably null Het
Trim43b C T 9: 89,091,480 D67N probably benign Het
Ubn2 T A 6: 38,463,726 C178S probably benign Het
Vmn1r54 T C 6: 90,269,325 F74L probably benign Het
Vmn2r24 A G 6: 123,779,185 H72R probably benign Het
Wdr66 G A 5: 123,287,305 V776I probably benign Het
Zan T G 5: 137,456,285 Y1419S unknown Het
Zbtb14 T A 17: 69,387,582 Y92N probably damaging Het
Zfand5 A G 19: 21,277,737 K116E probably benign Het
Zfhx3 A G 8: 108,947,961 E1881G possibly damaging Het
Zfp280b A G 10: 76,039,090 K268E probably benign Het
Zfp541 A G 7: 16,079,110 I563V probably benign Het
Zfy2 T A Y: 2,106,334 I767L probably benign Het
Other mutations in Wnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Wnk1 APN 6 119960708 missense probably damaging 1.00
IGL01364:Wnk1 APN 6 119937411 missense probably damaging 1.00
IGL01715:Wnk1 APN 6 119948397 missense probably damaging 1.00
IGL01951:Wnk1 APN 6 119963485 missense probably damaging 0.99
IGL02043:Wnk1 APN 6 119949078 unclassified probably benign
IGL02268:Wnk1 APN 6 119937373 nonsense probably null
IGL02348:Wnk1 APN 6 119963328 missense probably damaging 0.98
IGL02425:Wnk1 APN 6 119963454 missense probably damaging 1.00
IGL02850:Wnk1 APN 6 119937862 missense probably benign 0.26
IGL03160:Wnk1 APN 6 119926633 missense probably damaging 1.00
IGL03387:Wnk1 APN 6 119954187 missense possibly damaging 0.76
IGL03405:Wnk1 APN 6 119953895 missense probably benign 0.41
Narrow UTSW 6 119992408 missense probably damaging 1.00
nictitate UTSW 6 120002280 missense possibly damaging 0.88
opportunity UTSW 6 119951068 missense probably damaging 1.00
path UTSW 6 120037149 missense probably damaging 0.99
Unforgiving UTSW 6 119948282 missense probably damaging 1.00
Window UTSW 6 119992453 missense probably damaging 1.00
woke UTSW 6 119962955 missense probably benign 0.12
IGL03052:Wnk1 UTSW 6 119944799 splice site probably benign
PIT4480001:Wnk1 UTSW 6 119963367 nonsense probably null
R0044:Wnk1 UTSW 6 120037149 missense probably damaging 0.99
R0207:Wnk1 UTSW 6 119952733 missense probably damaging 1.00
R0333:Wnk1 UTSW 6 119928163 intron probably benign
R0453:Wnk1 UTSW 6 119963151 missense probably damaging 0.99
R0457:Wnk1 UTSW 6 119969332 missense probably damaging 1.00
R0501:Wnk1 UTSW 6 119962803 missense probably damaging 1.00
R0525:Wnk1 UTSW 6 119926564 missense probably damaging 1.00
R0526:Wnk1 UTSW 6 119951992 missense probably damaging 0.99
R0606:Wnk1 UTSW 6 119926683 missense probably damaging 1.00
R0658:Wnk1 UTSW 6 119948505 missense probably damaging 0.98
R1148:Wnk1 UTSW 6 119952006 splice site probably benign
R1188:Wnk1 UTSW 6 119948709 nonsense probably null
R1245:Wnk1 UTSW 6 119948457 missense probably benign 0.26
R1449:Wnk1 UTSW 6 119952818 missense probably damaging 1.00
R1469:Wnk1 UTSW 6 119950684 splice site probably benign
R1869:Wnk1 UTSW 6 119951089 missense probably damaging 1.00
R1871:Wnk1 UTSW 6 119951089 missense probably damaging 1.00
R1928:Wnk1 UTSW 6 119952923 missense probably damaging 1.00
R1959:Wnk1 UTSW 6 119969247 missense probably damaging 0.98
R1961:Wnk1 UTSW 6 119969247 missense probably damaging 0.98
R1964:Wnk1 UTSW 6 119934382 missense possibly damaging 0.86
R1983:Wnk1 UTSW 6 119937578 missense probably damaging 1.00
R2062:Wnk1 UTSW 6 119928157 splice site probably null
R2144:Wnk1 UTSW 6 119948988 unclassified probably benign
R2186:Wnk1 UTSW 6 119948567 missense probably benign 0.26
R2281:Wnk1 UTSW 6 119963640 splice site probably null
R2338:Wnk1 UTSW 6 119969534 missense probably benign 0.42
R2420:Wnk1 UTSW 6 119936367 critical splice donor site probably null
R3727:Wnk1 UTSW 6 119992453 missense probably damaging 1.00
R3773:Wnk1 UTSW 6 120002280 missense possibly damaging 0.88
R3836:Wnk1 UTSW 6 119950043 missense probably damaging 1.00
R3837:Wnk1 UTSW 6 119950043 missense probably damaging 1.00
R3847:Wnk1 UTSW 6 119969354 missense possibly damaging 0.70
R3903:Wnk1 UTSW 6 119949051 missense probably damaging 1.00
R4031:Wnk1 UTSW 6 119951068 missense probably damaging 1.00
R4095:Wnk1 UTSW 6 119948126 missense probably damaging 1.00
R4232:Wnk1 UTSW 6 119949261 missense possibly damaging 0.90
R4422:Wnk1 UTSW 6 119953895 missense probably benign 0.41
R4423:Wnk1 UTSW 6 119926426 missense probably damaging 1.00
R4572:Wnk1 UTSW 6 119951911 missense possibly damaging 0.49
R4704:Wnk1 UTSW 6 119965744 missense possibly damaging 0.83
R4755:Wnk1 UTSW 6 119963470 missense probably damaging 0.98
R4822:Wnk1 UTSW 6 119962438 missense probably benign 0.02
R4879:Wnk1 UTSW 6 119949377 missense probably damaging 1.00
R4970:Wnk1 UTSW 6 119965735 intron probably benign
R5002:Wnk1 UTSW 6 119937963 missense probably benign 0.13
R5037:Wnk1 UTSW 6 119965735 intron probably benign
R5152:Wnk1 UTSW 6 120002280 missense possibly damaging 0.88
R5257:Wnk1 UTSW 6 120037188 missense probably benign 0.00
R5354:Wnk1 UTSW 6 119968523 missense probably benign 0.01
R5421:Wnk1 UTSW 6 119952818 missense probably damaging 1.00
R5564:Wnk1 UTSW 6 119948891 unclassified probably benign
R5600:Wnk1 UTSW 6 119949358 missense probably damaging 1.00
R5847:Wnk1 UTSW 6 119992408 missense probably damaging 1.00
R6083:Wnk1 UTSW 6 120037601 missense probably damaging 0.99
R6110:Wnk1 UTSW 6 119972997 intron probably benign
R6128:Wnk1 UTSW 6 119963786 unclassified probably null
R6237:Wnk1 UTSW 6 119952767 missense probably damaging 1.00
R6341:Wnk1 UTSW 6 119948585 missense probably damaging 1.00
R6467:Wnk1 UTSW 6 119962955 missense probably benign 0.12
R6696:Wnk1 UTSW 6 119948282 missense probably damaging 1.00
R6888:Wnk1 UTSW 6 119948781 missense probably benign 0.26
R6923:Wnk1 UTSW 6 119965678 intron probably benign
R7024:Wnk1 UTSW 6 119965726 intron probably benign
R7072:Wnk1 UTSW 6 119937861 missense unknown
R7087:Wnk1 UTSW 6 120037530 missense possibly damaging 0.94
R7102:Wnk1 UTSW 6 119948307 missense unknown
R7134:Wnk1 UTSW 6 119926428 missense unknown
R7137:Wnk1 UTSW 6 120038212 unclassified probably benign
R7142:Wnk1 UTSW 6 119949279 missense probably benign 0.09
R7174:Wnk1 UTSW 6 119970978 missense probably damaging 1.00
R7218:Wnk1 UTSW 6 120002273 nonsense probably null
X0064:Wnk1 UTSW 6 120037032 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGCATTTCATTCTGCTGTAAGAC -3'
(R):5'- CCTCATTTCTGTCACAGGGC -3'

Sequencing Primer
(F):5'- AATGTGTTTTAAATAAGGGGAGCCTG -3'
(R):5'- GGGCTTCCCATCTCGACTG -3'
Posted On2016-02-04